Incidental Mutation 'R5189:Trip10'
ID405075
Institutional Source Beutler Lab
Gene Symbol Trip10
Ensembl Gene ENSMUSG00000019487
Gene Namethyroid hormone receptor interactor 10
SynonymsCip4
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.822) question?
Stock #R5189 (G1)
Quality Score117
Status Not validated
Chromosome17
Chromosomal Location57249455-57263665 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 57261288 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019631] [ENSMUST00000224152] [ENSMUST00000224885] [ENSMUST00000224947]
Predicted Effect probably null
Transcript: ENSMUST00000019631
SMART Domains Protein: ENSMUSP00000019631
Gene: ENSMUSG00000019487

DomainStartEndE-ValueType
FCH 1 94 9.95e-29 SMART
coiled coil region 117 197 N/A INTRINSIC
low complexity region 310 318 N/A INTRINSIC
PDB:2KE4|A 332 425 3e-35 PDB
low complexity region 433 455 N/A INTRINSIC
low complexity region 458 467 N/A INTRINSIC
SH3 489 546 2.44e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000224152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224261
Predicted Effect probably null
Transcript: ENSMUST00000224885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224904
Predicted Effect probably null
Transcript: ENSMUST00000224947
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin-stimulated glucose uptake in adipocytes and decreased circulating glucose levels. Mice homozygous for another knock-out allele exhibit impaired integrin-dependent T-cell trafficking. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Trip10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Trip10 APN 17 57254332 missense possibly damaging 0.91
IGL01639:Trip10 APN 17 57254165 unclassified probably benign
IGL01758:Trip10 APN 17 57261409 missense possibly damaging 0.51
IGL02184:Trip10 APN 17 57257272 missense probably damaging 1.00
IGL02554:Trip10 APN 17 57263135 missense probably damaging 0.99
IGL02641:Trip10 APN 17 57262411 missense probably benign 0.06
R0092:Trip10 UTSW 17 57250798 missense possibly damaging 0.46
R0139:Trip10 UTSW 17 57261633 splice site probably null
R0179:Trip10 UTSW 17 57262349 splice site probably benign
R1173:Trip10 UTSW 17 57253363 missense probably damaging 0.98
R1416:Trip10 UTSW 17 57250800 missense probably damaging 1.00
R2223:Trip10 UTSW 17 57263039 missense possibly damaging 0.70
R2259:Trip10 UTSW 17 57255135 missense probably benign 0.00
R3950:Trip10 UTSW 17 57253411 critical splice donor site probably null
R4420:Trip10 UTSW 17 57255448 missense probably benign 0.05
R4643:Trip10 UTSW 17 57261658 nonsense probably null
R4940:Trip10 UTSW 17 57263017 missense possibly damaging 0.65
R5595:Trip10 UTSW 17 57262460 missense probably damaging 1.00
R5946:Trip10 UTSW 17 57250963 missense probably damaging 0.99
R6613:Trip10 UTSW 17 57255197 intron probably null
R6738:Trip10 UTSW 17 57256899 missense probably benign
R6948:Trip10 UTSW 17 57262448 missense probably damaging 1.00
R6994:Trip10 UTSW 17 57255331 missense probably damaging 1.00
R7489:Trip10 UTSW 17 57250966 missense probably damaging 1.00
R7729:Trip10 UTSW 17 57262442 missense probably damaging 1.00
R7750:Trip10 UTSW 17 57261667 missense possibly damaging 0.58
RF024:Trip10 UTSW 17 57255045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTATGAGCACGTGTAGC -3'
(R):5'- AGTGACTCATGCAGCTCTG -3'

Sequencing Primer
(F):5'- ACTGACATGCTGCTCAGATG -3'
(R):5'- AGCTCTGCCTGCCACCAG -3'
Posted On2016-07-22