Incidental Mutation 'R5189:Kank1'
ID405078
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25424181 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1051 (S1051P)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect probably damaging
Transcript: ENSMUST00000049400
AA Change: S1023P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: S1023P

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146647
AA Change: S1051P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: S1051P

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155788
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Il12rb1 A G 8: 70,811,058 T88A possibly damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1681:Kank1 UTSW 19 25410304 missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R3153:Kank1 UTSW 19 25410688 missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25411072 missense probably benign 0.10
R4670:Kank1 UTSW 19 25410580 missense probably benign 0.00
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25430341 missense probably damaging 1.00
R7405:Kank1 UTSW 19 25410319 nonsense probably null
R7486:Kank1 UTSW 19 25410829 missense probably damaging 0.99
R7602:Kank1 UTSW 19 25422161 missense probably benign 0.01
R7701:Kank1 UTSW 19 25411765 critical splice donor site probably null
R7765:Kank1 UTSW 19 25411205 frame shift probably null
R7766:Kank1 UTSW 19 25411205 frame shift probably null
R7768:Kank1 UTSW 19 25411205 frame shift probably null
R8020:Kank1 UTSW 19 25411205 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCCATTGTAAACTTACCAGGCC -3'
(R):5'- AGGCTCACATTCTGGAACC -3'

Sequencing Primer
(F):5'- GGCCTTCAAATAGACCTTGCTTTGAG -3'
(R):5'- GCTCACATTCTGGAACCTGCAC -3'
Posted On2016-07-22