Incidental Mutation 'R5192:Gm38100'
ID405081
Institutional Source Beutler Lab
Gene Symbol Gm38100
Ensembl Gene ENSMUSG00000104158
Gene Namepredicted gene, 38100
Synonyms
MMRRC Submission 042768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R5192 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location175920329-175922225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 175920842 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 158 (D158G)
Ref Sequence ENSEMBL: ENSMUSP00000144267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000194391] [ENSMUST00000201297]
Predicted Effect probably benign
Transcript: ENSMUST00000194391
AA Change: D158G

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000144267
Gene: ENSMUSG00000104158
AA Change: D158G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:APG6 126 440 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201297
AA Change: D158G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143887
Gene: ENSMUSG00000104158
AA Change: D158G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:APG6 126 440 6.1e-95 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Babam1 T C 8: 71,404,253 V286A probably damaging Het
Cep192 T C 18: 67,835,004 I853T probably benign Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Dnah17 T C 11: 118,034,359 T3883A possibly damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Gm156 T C 6: 129,771,758 T99A probably benign Het
Gm9988 T C 8: 88,138,373 probably benign Het
Gstm1 A G 3: 108,014,943 probably null Het
Hsfy2 T A 1: 56,636,735 K214N probably benign Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
March10 T C 11: 105,371,926 H735R possibly damaging Het
Myo1g T C 11: 6,514,816 D486G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr906 T C 9: 38,488,805 Y259H possibly damaging Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prep T C 10: 45,153,111 Y536H probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tmtc2 G A 10: 105,190,177 P810L probably damaging Het
Tollip C T 7: 141,892,117 R9H probably damaging Het
Vmn2r57 A T 7: 41,427,939 S268T probably damaging Het
Vps51 A G 19: 6,070,467 V472A possibly damaging Het
Zfp608 C A 18: 54,898,497 K790N probably damaging Het
Zfp661 A G 2: 127,577,062 V386A possibly damaging Het
Other mutations in Gm38100
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3623:Gm38100 UTSW 1 175920631 missense possibly damaging 0.88
R3922:Gm38100 UTSW 1 175921286 missense probably benign 0.00
R3925:Gm38100 UTSW 1 175921286 missense probably benign 0.00
R3926:Gm38100 UTSW 1 175921286 missense probably benign 0.00
R5275:Gm38100 UTSW 1 175920770 missense probably benign 0.07
R5666:Gm38100 UTSW 1 175921613 missense probably damaging 1.00
R5670:Gm38100 UTSW 1 175921613 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCCATGAGAACTATGAAC -3'
(R):5'- AAACAGAGTACTCGACCCTGTG -3'

Sequencing Primer
(F):5'- TCCATGAGAACTATGAACACTATCC -3'
(R):5'- GACCCTGTGCTGCTCATG -3'
Posted On2016-07-22