Incidental Mutation 'R5192:Tollip'
ID405090
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Nametoll interacting protein
Synonyms4930403G24Rik, Toll interacting protein, 4931428G15Rik
MMRRC Submission 042768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5192 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141874813-141918507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141892117 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 9 (R9H)
Ref Sequence ENSEMBL: ENSMUSP00000118336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
Predicted Effect probably damaging
Transcript: ENSMUST00000001950
AA Change: R78H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: R78H

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000055819
AA Change: R78H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139
AA Change: R78H

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130439
AA Change: R74H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: R74H

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151890
AA Change: R9H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: R9H

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211231
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Babam1 T C 8: 71,404,253 V286A probably damaging Het
Cep192 T C 18: 67,835,004 I853T probably benign Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Dnah17 T C 11: 118,034,359 T3883A possibly damaging Het
Dzip1 C T 14: 118,911,393 M291I probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Gm156 T C 6: 129,771,758 T99A probably benign Het
Gm38100 A G 1: 175,920,842 D158G probably benign Het
Gm9988 T C 8: 88,138,373 probably benign Het
Gstm1 A G 3: 108,014,943 probably null Het
Hsfy2 T A 1: 56,636,735 K214N probably benign Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
March10 T C 11: 105,371,926 H735R possibly damaging Het
Myo1g T C 11: 6,514,816 D486G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr906 T C 9: 38,488,805 Y259H possibly damaging Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prep T C 10: 45,153,111 Y536H probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Tmtc2 G A 10: 105,190,177 P810L probably damaging Het
Vmn2r57 A T 7: 41,427,939 S268T probably damaging Het
Vps51 A G 19: 6,070,467 V472A possibly damaging Het
Zfp608 C A 18: 54,898,497 K790N probably damaging Het
Zfp661 A G 2: 127,577,062 V386A possibly damaging Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R4092:Tollip UTSW 7 141884443 missense probably damaging 1.00
R5614:Tollip UTSW 7 141892088 missense probably damaging 1.00
R6132:Tollip UTSW 7 141889597 missense probably benign 0.37
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R6830:Tollip UTSW 7 141898714 start codon destroyed probably null 0.00
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R7759:Tollip UTSW 7 141884539 missense probably benign
R8024:Tollip UTSW 7 141892826 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACCCATGTCTGTCAGATCCC -3'
(R):5'- GCAGCATGTTCAAGAGCAGG -3'

Sequencing Primer
(F):5'- TGTCTGTCAGATCCCAAACTAG -3'
(R):5'- CTGACACGATTAGGTGAACTTG -3'
Posted On2016-07-22