Incidental Mutation 'R0497:Pard3b'
ID40511
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Namepar-3 family cell polarity regulator beta
SynonymsPAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0497 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location61638824-62642284 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 62440008 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
Predicted Effect probably null
Transcript: ENSMUST00000046673
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075374
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000094906
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R1264:Pard3b UTSW 1 62164157 missense probably damaging 1.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1482:Pard3b UTSW 1 62166367 missense probably damaging 1.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3712:Pard3b UTSW 1 62343978 missense probably damaging 1.00
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5930:Pard3b UTSW 1 61768130 intron probably benign
R5950:Pard3b UTSW 1 62216531 missense probably benign 0.04
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTTAAAGTGTGGCAATGGACTGC -3'
(R):5'- AGGTCCCAGTTCTCTGGTATGCTTC -3'

Sequencing Primer
(F):5'- GAGGGTCTCATTAGAAAATTGTTCAG -3'
(R):5'- TCCCTCCAGTTGATTATTGGAAG -3'
Posted On2013-05-23