Incidental Mutation 'R5291:Olfr1259'
ID405128
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R5291 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 89943436 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 226 (Y226*)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect probably null
Transcript: ENSMUST00000090695
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214846
AA Change: Y226*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,585,937 S328G probably damaging Het
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Mkln1 T A 6: 31,490,481 N43K possibly damaging Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Scarf1 T C 11: 75,524,074 S525P probably damaging Het
Senp7 T A 16: 56,186,179 Y982* probably null Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Spred3 T A 7: 29,167,830 H47L probably damaging Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0366:Olfr1259 UTSW 2 89943818 missense possibly damaging 0.89
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R0587:Olfr1259 UTSW 2 89943392 missense probably damaging 1.00
R1383:Olfr1259 UTSW 2 89943551 missense probably benign 0.12
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R2330:Olfr1259 UTSW 2 89943953 missense probably benign
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R3955:Olfr1259 UTSW 2 89943828 missense possibly damaging 0.90
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R6858:Olfr1259 UTSW 2 89943743 missense probably damaging 0.99
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
R8261:Olfr1259 UTSW 2 89943372 missense probably benign 0.00
R8319:Olfr1259 UTSW 2 89943680 missense possibly damaging 0.87
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATTCAGCATAGGAGCCAC -3'
(R):5'- GAGGATTTCTCCATGCAACTATTC -3'

Sequencing Primer
(F):5'- GATTCAGCATAGGAGCCACCATAG -3'
(R):5'- TCTGTGGCCCCAACATCATAG -3'
Posted On2016-07-22