Incidental Mutation 'R5291:Mkln1'
ID 405144
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R5291 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31490481 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 43 (N43K)
Ref Sequence ENSEMBL: ENSMUSP00000123048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699] [ENSMUST00000130108]
AlphaFold O89050
Predicted Effect probably benign
Transcript: ENSMUST00000026699
AA Change: N571K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: N571K

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130108
AA Change: N43K

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123048
Gene: ENSMUSG00000025609
AA Change: N43K

DomainStartEndE-ValueType
SCOP:d1k3ia3 1 93 8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150949
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,585,937 S328G probably damaging Het
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Olfr1259 A T 2: 89,943,436 Y226* probably null Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Scarf1 T C 11: 75,524,074 S525P probably damaging Het
Senp7 T A 16: 56,186,179 Y982* probably null Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Spred3 T A 7: 29,167,830 H47L probably damaging Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0518:Mkln1 UTSW 6 31468132 missense probably benign 0.00
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense not run
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTCTGACATGAACAAGTGTCC -3'
(R):5'- AAGTGTCACGAATTATGGACCATAC -3'

Sequencing Primer
(F):5'- CTCTGACATGAACAAGTGTCCATTTG -3'
(R):5'- AGGCATCCTGGGCAATTTAC -3'
Posted On 2016-07-22