Incidental Mutation 'R5291:Spred3'
ID405150
Institutional Source Beutler Lab
Gene Symbol Spred3
Ensembl Gene ENSMUSG00000037239
Gene Namesprouty-related, EVH1 domain containing 3
SynonymsD130060H24Rik, Spred-3
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5291 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29158829-29170411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29167830 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 47 (H47L)
Ref Sequence ENSEMBL: ENSMUSP00000046216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033886] [ENSMUST00000048923] [ENSMUST00000098609] [ENSMUST00000208288] [ENSMUST00000208330] [ENSMUST00000209019]
Predicted Effect probably benign
Transcript: ENSMUST00000033886
SMART Domains Protein: ENSMUSP00000033886
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000048923
AA Change: H47L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046216
Gene: ENSMUSG00000037239
AA Change: H47L

DomainStartEndE-ValueType
Pfam:WH1 1 110 1.6e-13 PFAM
low complexity region 120 130 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Pfam:Sprouty 292 400 7.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098609
SMART Domains Protein: ENSMUSP00000096209
Gene: ENSMUSG00000031493

DomainStartEndE-ValueType
Pfam:GGN 38 342 2.1e-158 PFAM
Pfam:GGN 340 709 1.5e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207778
Predicted Effect probably benign
Transcript: ENSMUST00000208288
Predicted Effect probably benign
Transcript: ENSMUST00000208330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208659
Predicted Effect probably benign
Transcript: ENSMUST00000209019
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a C-terminal Sprouty-like cysteine-rich domain (SRY) and an N-terminal Ena/Vasodilator-stimulated phosphoprotein (VASP) homology-1 (EVH-1) domain. The encoded protein is a member of a family of proteins that negatively regulates mitogen-activated protein (MAP) kinase signaling, particularly during organogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,585,937 S328G probably damaging Het
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Mkln1 T A 6: 31,490,481 N43K possibly damaging Het
Olfr1259 A T 2: 89,943,436 Y226* probably null Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Scarf1 T C 11: 75,524,074 S525P probably damaging Het
Senp7 T A 16: 56,186,179 Y982* probably null Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in Spred3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Spred3 APN 7 29161523 utr 3 prime probably benign
IGL02391:Spred3 APN 7 29166405 missense probably benign 0.00
IGL03355:Spred3 APN 7 29161572 missense unknown
R0480:Spred3 UTSW 7 29162975 missense probably damaging 0.99
R2396:Spred3 UTSW 7 29166634 missense probably damaging 1.00
R4161:Spred3 UTSW 7 29161785 missense probably damaging 1.00
R4899:Spred3 UTSW 7 29161833 missense probably damaging 1.00
R4974:Spred3 UTSW 7 29167824 missense probably damaging 1.00
R6192:Spred3 UTSW 7 29162977 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGATTGAACAGCCAGAGAAGC -3'
(R):5'- TAGGGAGAACGCTCAAACCG -3'

Sequencing Primer
(F):5'- GCAGAGGACAGGAGCTTCC -3'
(R):5'- CAAGATTTGAGTTCACGGCC -3'
Posted On2016-07-22