Incidental Mutation 'R5291:Slc35b2'
ID405172
Institutional Source Beutler Lab
Gene Symbol Slc35b2
Ensembl Gene ENSMUSG00000037089
Gene Namesolute carrier family 35, member B2
SynonymsPAPST1, 1110003M08Rik
MMRRC Submission 042874-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5291 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45563874-45567671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45566498 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 184 (Y184H)
Ref Sequence ENSEMBL: ENSMUSP00000153367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000024742] [ENSMUST00000041353] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905] [ENSMUST00000226086]
Predicted Effect probably benign
Transcript: ENSMUST00000024739
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024742
SMART Domains Protein: ENSMUSP00000024742
Gene: ENSMUSG00000023947

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
low complexity region 93 110 N/A INTRINSIC
ANK 122 152 1.14e2 SMART
ANK 157 187 2.15e0 SMART
ANK 190 219 6.81e-3 SMART
ANK 233 262 5.09e-2 SMART
ANK 267 296 1.12e-3 SMART
ANK 300 329 1e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041353
AA Change: Y135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089
AA Change: Y135H

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect probably benign
Transcript: ENSMUST00000163966
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223987
AA Change: Y135H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably damaging
Transcript: ENSMUST00000224905
AA Change: Y184H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225226
Predicted Effect probably benign
Transcript: ENSMUST00000226086
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferases (e.g., SULT4A1; MIM 608359) use an activated form of sulfate, 3-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS), as a common sulfate donor for sulfation of glycoproteins, proteoglycans, and glycolipids in the endoplasmic reticulum and Golgi apparatus. SLC35B2 is located in the microsomal membrane and transports PAPS from the cytosol, where it is synthesized, into the Golgi lumen (Kamiyama et al., 2003 [PubMed 12716889]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T C 14: 54,585,937 S328G probably damaging Het
Acot5 T G 12: 84,073,519 L216R probably benign Het
Ankrd6 A G 4: 32,823,446 L192P probably damaging Het
Atp6v1e1 C A 6: 120,818,333 probably null Het
Bbs9 T C 9: 22,628,997 Y358H probably damaging Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Camk2a A G 18: 60,957,164 K192R probably damaging Het
Ceacam1 T A 7: 25,471,831 R223W probably damaging Het
Cntn6 T A 6: 104,726,135 F173I probably damaging Het
Cntrl A C 2: 35,134,060 I33L probably damaging Het
Crybg2 T C 4: 134,073,427 S633P probably benign Het
Cyp2j13 T C 4: 96,068,329 H181R probably damaging Het
Dlgap1 A G 17: 70,718,210 S542G probably benign Het
Dnm2 T G 9: 21,478,907 L402R probably damaging Het
Fndc3b C A 3: 27,642,995 V23L probably benign Het
Gata4 A C 14: 63,240,599 F184V probably damaging Het
Gcnt2 A G 13: 40,918,792 R304G probably damaging Het
Gm10563 TTTC TTTCCTTC 4: 155,614,512 probably benign Het
Gm26558 G A 2: 70,661,529 probably benign Het
Grip1 G A 10: 120,086,969 V1107I probably benign Het
Herpud2 C T 9: 25,124,960 G135S probably benign Het
Lrp1 A G 10: 127,593,878 I441T probably damaging Het
Lrp1b T C 2: 40,903,003 D2553G probably damaging Het
Mkln1 T A 6: 31,490,481 N43K possibly damaging Het
Olfr1259 A T 2: 89,943,436 Y226* probably null Het
Olfr181 T C 16: 58,926,401 T57A possibly damaging Het
Paxbp1 C T 16: 91,044,352 M1I probably null Het
Phip A G 9: 82,945,883 Y97H probably damaging Het
Plec T A 15: 76,174,011 I3774F probably damaging Het
Pramef6 G T 4: 143,895,667 P373T probably damaging Het
Prrc2c C A 1: 162,705,582 probably benign Het
Prss12 T C 3: 123,505,463 L628P probably damaging Het
Ptpre G A 7: 135,678,301 V578I probably benign Het
Qsox2 A T 2: 26,217,698 L261H probably damaging Het
Rapgef2 A T 3: 79,070,059 V1327E possibly damaging Het
Rnf216 A G 5: 143,090,212 S306P probably benign Het
Rtel1 A G 2: 181,352,095 Q640R possibly damaging Het
Ryr1 T A 7: 29,115,598 D175V probably benign Het
Scarf1 T C 11: 75,524,074 S525P probably damaging Het
Senp7 T A 16: 56,186,179 Y982* probably null Het
Sned1 A G 1: 93,295,724 K1375E possibly damaging Het
Spats2 G T 15: 99,178,541 A167S probably benign Het
Spen C A 4: 141,488,079 A481S unknown Het
Spred3 T A 7: 29,167,830 H47L probably damaging Het
Srsf4 T A 4: 131,886,306 probably benign Het
Tdrd3 A T 14: 87,505,798 H394L probably benign Het
Terf1 A G 1: 15,819,086 probably null Het
Txlnb A T 10: 17,799,396 D99V possibly damaging Het
Ugt1a7c A T 1: 88,095,509 N130I possibly damaging Het
Vmn2r50 T A 7: 10,047,825 D331V probably damaging Het
Vps13d A G 4: 145,062,569 I744T probably damaging Het
Ythdc1 A G 5: 86,835,688 D664G probably damaging Het
Other mutations in Slc35b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Slc35b2 APN 17 45564960 missense probably damaging 0.99
IGL02749:Slc35b2 APN 17 45566567 missense probably benign 0.14
IGL02951:Slc35b2 APN 17 45564768 missense probably damaging 1.00
IGL03382:Slc35b2 APN 17 45566645 missense probably damaging 0.98
R0020:Slc35b2 UTSW 17 45566856 missense probably damaging 1.00
R0368:Slc35b2 UTSW 17 45566463 missense probably benign
R0743:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R0884:Slc35b2 UTSW 17 45566825 missense probably damaging 1.00
R2293:Slc35b2 UTSW 17 45567141 missense probably damaging 1.00
R3894:Slc35b2 UTSW 17 45566442 missense probably benign 0.01
R4372:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4415:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4416:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R4417:Slc35b2 UTSW 17 45566429 missense probably benign 0.34
R5314:Slc35b2 UTSW 17 45566498 missense probably damaging 1.00
R5929:Slc35b2 UTSW 17 45566661 missense probably benign 0.35
R6178:Slc35b2 UTSW 17 45566376 missense probably benign 0.10
R7217:Slc35b2 UTSW 17 45565029 missense probably benign 0.19
R7561:Slc35b2 UTSW 17 45566801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACTTGGGGCATACTGC -3'
(R):5'- TGGATAGAAGAAACATGCTCACTC -3'

Sequencing Primer
(F):5'- CATACTGCAGGAAAGAGTGATGACTG -3'
(R):5'- AGGCCGGCAGTCAGGTATTC -3'
Posted On2016-07-22