Incidental Mutation 'R0497:Trim32'
ID40520
Institutional Source Beutler Lab
Gene Symbol Trim32
Ensembl Gene ENSMUSG00000051675
Gene Nametripartite motif-containing 32
Synonyms1810045E12Rik, Zfp117, BBS11, 3f3
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.862) question?
Stock #R0497 (G1)
Quality Score194
Status Validated
Chromosome4
Chromosomal Location65604986-65616238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65613254 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 16 (R16Q)
Ref Sequence ENSEMBL: ENSMUSP00000119579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050850] [ENSMUST00000068214] [ENSMUST00000084496] [ENSMUST00000107366] [ENSMUST00000155978] [ENSMUST00000156922]
Predicted Effect probably damaging
Transcript: ENSMUST00000050850
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062277
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 471 498 6.9e-7 PFAM
Pfam:NHL 618 645 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068214
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084496
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107366
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102989
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 373 400 3.6e-7 PFAM
Pfam:NHL 471 498 2.7e-7 PFAM
Pfam:NHL 618 645 2.5e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155978
AA Change: R16Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119579
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
Blast:BBOX 96 136 3e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000156922
AA Change: R16Q

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121949
Gene: ENSMUSG00000051675
AA Change: R16Q

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
Meta Mutation Damage Score 0.1654 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. Mice homozygous for a knock-out allele exhibit impaired adult muscle regeneration and myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Trim32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Trim32 APN 4 65614499 missense probably damaging 1.00
IGL02534:Trim32 APN 4 65614669 missense possibly damaging 0.72
R0302:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0356:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0358:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0544:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0547:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0611:Trim32 UTSW 4 65613656 missense possibly damaging 0.71
R1183:Trim32 UTSW 4 65614391 missense probably benign 0.00
R1523:Trim32 UTSW 4 65614004 missense probably benign 0.04
R1784:Trim32 UTSW 4 65614397 missense probably damaging 0.96
R1939:Trim32 UTSW 4 65614066 missense probably benign
R2069:Trim32 UTSW 4 65614776 nonsense probably null
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R3875:Trim32 UTSW 4 65613466 missense possibly damaging 0.93
R5464:Trim32 UTSW 4 65614388 missense probably damaging 1.00
R6246:Trim32 UTSW 4 65614564 missense probably damaging 1.00
R6610:Trim32 UTSW 4 65615071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTTACCCAGTTGTCAGGCTC -3'
(R):5'- ATCTTCAGCACCGTCAGGTTGTCG -3'

Sequencing Primer
(F):5'- gtgtgtatgtAAGGGGAGGG -3'
(R):5'- CCGTCAGGTTGTCGGTCAG -3'
Posted On2013-05-23