Incidental Mutation 'R5292:Crtc3'
ID405201
Institutional Source Beutler Lab
Gene Symbol Crtc3
Ensembl Gene ENSMUSG00000030527
Gene NameCREB regulated transcription coactivator 3
Synonyms
MMRRC Submission 042875-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R5292 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80586627-80688877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80618610 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000113540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000122255
AA Change: T154A

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113540
Gene: ENSMUSG00000030527
AA Change: T154A

DomainStartEndE-ValueType
Pfam:TORC_N 11 82 1.2e-20 PFAM
Pfam:TORC_M 159 321 1.9e-64 PFAM
low complexity region 366 380 N/A INTRINSIC
low complexity region 438 480 N/A INTRINSIC
Pfam:TORC_C 545 619 2.2e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127326
AA Change: T39A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154761
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CREB regulated transcription coactivator gene family. This family regulates CREB-dependent gene transcription in a phosphorylation-independent manner and may be selective for cAMP-responsive genes. The protein encoded by this gene may induce mitochondrial biogenesis and attenuate catecholamine signaling in adipose tissue. A translocation event between this gene and Notch coactivator mastermind-like gene 2, which results in a fusion protein, has been reported in mucoepidermoid carcinomas. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null mutation display resistance to diet-induced obesity, increased energy expenditure, decreased white adipose tissue mass, increased brown adipose cell numbers, and increased core temperature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,864,451 V641A possibly damaging Het
Akap2 T G 4: 57,855,356 S471R probably damaging Het
Apob A T 12: 8,005,912 M1465L probably benign Het
Astn1 T C 1: 158,580,363 probably null Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Col22a1 T C 15: 71,970,336 Y433C probably damaging Het
Dcc T C 18: 71,306,088 Y1241C probably damaging Het
Depdc1b T C 13: 108,373,842 V296A probably damaging Het
E430018J23Rik T C 7: 127,392,487 D97G possibly damaging Het
Gata3 A G 2: 9,868,874 S270P probably damaging Het
Gcm1 T C 9: 78,061,426 F136S probably damaging Het
Gfpt1 A G 6: 87,076,255 probably null Het
Gm5174 G T 10: 86,656,698 noncoding transcript Het
Hhipl1 A G 12: 108,327,778 T648A probably benign Het
Hr C A 14: 70,571,992 Q1177K probably damaging Het
Hrnr T C 3: 93,331,892 S3146P unknown Het
Igkv10-94 C T 6: 68,704,598 G86E probably damaging Het
Krt80 G A 15: 101,352,185 R222W probably damaging Het
Lrch3 T C 16: 32,975,807 Y354H probably damaging Het
Olfr1133 T A 2: 87,645,995 N43Y probably damaging Het
Olfr1510 A T 14: 52,410,445 N142K possibly damaging Het
Olfr401 T A 11: 74,122,051 F254Y probably damaging Het
Osbpl7 A G 11: 97,067,953 D932G probably benign Het
Palmd T C 3: 116,923,744 E368G probably benign Het
Peg3 T A 7: 6,708,260 D1321V probably damaging Het
Pkhd1l1 A T 15: 44,529,566 I1766F probably damaging Het
Polq A G 16: 37,061,383 E1303G probably damaging Het
Ppie A G 4: 123,139,908 Y9H probably damaging Het
Ptprz1 A G 6: 23,002,582 N1557S probably benign Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rtn4 T C 11: 29,707,924 F577L probably benign Het
Sacs A G 14: 61,211,983 Y3826C probably damaging Het
Slc32a1 A G 2: 158,611,387 D49G probably damaging Het
Slc37a2 A T 9: 37,239,157 C167* probably null Het
Slc5a1 G T 5: 33,158,241 V535F probably benign Het
Smoc2 A G 17: 14,336,573 K95E probably damaging Het
Smok3c A C 5: 138,065,184 Q311P probably damaging Het
Spink5 C A 18: 44,006,454 P628Q probably benign Het
Spint4 T C 2: 164,700,859 L124S probably benign Het
Stard9 A G 2: 120,699,145 K1961R probably benign Het
Synpo2 C A 3: 123,114,060 V536L possibly damaging Het
Trim24 A G 6: 37,903,604 K146E probably benign Het
Usp24 A G 4: 106,418,263 D2245G probably benign Het
Vars2 A G 17: 35,660,786 S81P probably damaging Het
Zfp39 T C 11: 58,900,589 T91A probably damaging Het
Zfp936 T A 7: 43,189,335 Y75* probably null Het
Zkscan5 G T 5: 145,218,641 C374F probably damaging Het
Other mutations in Crtc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Crtc3 APN 7 80598739 intron probably benign
IGL01325:Crtc3 APN 7 80677368 missense probably damaging 0.96
IGL01802:Crtc3 APN 7 80604368 nonsense probably null
IGL02166:Crtc3 APN 7 80677399 missense probably damaging 1.00
IGL02601:Crtc3 APN 7 80592567 missense probably damaging 1.00
IGL02719:Crtc3 APN 7 80618658 critical splice acceptor site probably null
IGL02936:Crtc3 APN 7 80589763 missense probably damaging 1.00
IGL03075:Crtc3 APN 7 80604403 intron probably benign
R0856:Crtc3 UTSW 7 80595624 missense probably damaging 0.99
R1655:Crtc3 UTSW 7 80598776 missense possibly damaging 0.67
R1962:Crtc3 UTSW 7 80589931 missense probably damaging 1.00
R4484:Crtc3 UTSW 7 80589948 missense probably damaging 1.00
R4533:Crtc3 UTSW 7 80589795 missense probably damaging 0.97
R4818:Crtc3 UTSW 7 80677422 missense possibly damaging 0.65
R5908:Crtc3 UTSW 7 80595794 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACTGACTACACTATCTCCTACATAGTC -3'
(R):5'- CCAGCTAGCTGATGTTGTGG -3'

Sequencing Primer
(F):5'- CCTGGCTAATCAAATCTGTCT -3'
(R):5'- TCCTGAGAGATCATTCAGTCAGGC -3'
Posted On2016-07-22