Incidental Mutation 'R5292:Gm5174'
ID 405206
Institutional Source Beutler Lab
Gene Symbol Gm5174
Ensembl Gene ENSMUSG00000090308
Gene Name predicted gene 5174
Synonyms
MMRRC Submission 042875-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5292 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86655939-86657381 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to T at 86656698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171131
SMART Domains Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

DomainStartEndE-ValueType
S_TKc 14 262 5.59e-86 SMART
UBA 276 313 1.28e-3 SMART
low complexity region 447 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219608
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,864,451 V641A possibly damaging Het
Akap2 T G 4: 57,855,356 S471R probably damaging Het
Apob A T 12: 8,005,912 M1465L probably benign Het
Astn1 T C 1: 158,580,363 probably null Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Col22a1 T C 15: 71,970,336 Y433C probably damaging Het
Crtc3 T C 7: 80,618,610 T154A possibly damaging Het
Dcc T C 18: 71,306,088 Y1241C probably damaging Het
Depdc1b T C 13: 108,373,842 V296A probably damaging Het
E430018J23Rik T C 7: 127,392,487 D97G possibly damaging Het
Gata3 A G 2: 9,868,874 S270P probably damaging Het
Gcm1 T C 9: 78,061,426 F136S probably damaging Het
Gfpt1 A G 6: 87,076,255 probably null Het
Hhipl1 A G 12: 108,327,778 T648A probably benign Het
Hr C A 14: 70,571,992 Q1177K probably damaging Het
Hrnr T C 3: 93,331,892 S3146P unknown Het
Igkv10-94 C T 6: 68,704,598 G86E probably damaging Het
Krt80 G A 15: 101,352,185 R222W probably damaging Het
Lrch3 T C 16: 32,975,807 Y354H probably damaging Het
Olfr1133 T A 2: 87,645,995 N43Y probably damaging Het
Olfr1510 A T 14: 52,410,445 N142K possibly damaging Het
Olfr401 T A 11: 74,122,051 F254Y probably damaging Het
Osbpl7 A G 11: 97,067,953 D932G probably benign Het
Palmd T C 3: 116,923,744 E368G probably benign Het
Peg3 T A 7: 6,708,260 D1321V probably damaging Het
Pkhd1l1 A T 15: 44,529,566 I1766F probably damaging Het
Polq A G 16: 37,061,383 E1303G probably damaging Het
Ppie A G 4: 123,139,908 Y9H probably damaging Het
Ptprz1 A G 6: 23,002,582 N1557S probably benign Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rtn4 T C 11: 29,707,924 F577L probably benign Het
Sacs A G 14: 61,211,983 Y3826C probably damaging Het
Slc32a1 A G 2: 158,611,387 D49G probably damaging Het
Slc37a2 A T 9: 37,239,157 C167* probably null Het
Slc5a1 G T 5: 33,158,241 V535F probably benign Het
Smoc2 A G 17: 14,336,573 K95E probably damaging Het
Smok3c A C 5: 138,065,184 Q311P probably damaging Het
Spink5 C A 18: 44,006,454 P628Q probably benign Het
Spint4 T C 2: 164,700,859 L124S probably benign Het
Stard9 A G 2: 120,699,145 K1961R probably benign Het
Synpo2 C A 3: 123,114,060 V536L possibly damaging Het
Trim24 A G 6: 37,903,604 K146E probably benign Het
Usp24 A G 4: 106,418,263 D2245G probably benign Het
Vars2 A G 17: 35,660,786 S81P probably damaging Het
Zfp39 T C 11: 58,900,589 T91A probably damaging Het
Zfp936 T A 7: 43,189,335 Y75* probably null Het
Zkscan5 G T 5: 145,218,641 C374F probably damaging Het
Other mutations in Gm5174
AlleleSourceChrCoordTypePredicted EffectPPH Score
Laco UTSW 10 86656108 unclassified noncoding transcript
R1083:Gm5174 UTSW 10 86656108 unclassified noncoding transcript
R1199:Gm5174 UTSW 10 86657325 unclassified noncoding transcript
R1296:Gm5174 UTSW 10 86657002 unclassified noncoding transcript
R1715:Gm5174 UTSW 10 86656912 unclassified noncoding transcript
R1957:Gm5174 UTSW 10 86656753 unclassified noncoding transcript
R2221:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R2223:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R3104:Gm5174 UTSW 10 86656655 unclassified noncoding transcript
R4165:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4166:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4243:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R4244:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R5024:Gm5174 UTSW 10 86656587 unclassified noncoding transcript
R5586:Gm5174 UTSW 10 86656545 unclassified noncoding transcript
R5864:Gm5174 UTSW 10 86657181 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTGGGCGCCAGAGATACTG -3'
(R):5'- AGCAAATATGTCCCCATGTTCTC -3'

Sequencing Primer
(F):5'- GCGCCAGAGATACTGCTAGG -3'
(R):5'- AATATGTCCCCATGTTCTCATCAAAC -3'
Posted On 2016-07-22