Incidental Mutation 'R0497:Nwd2'
ID40521
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R0497 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63806343 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 1090 (W1090L)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584]
Predicted Effect probably damaging
Transcript: ENSMUST00000159584
AA Change: W1090L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: W1090L

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Meta Mutation Damage Score 0.0962 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63806571 missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63725197 missense not run
Z1176:Nwd2 UTSW 5 63806157 missense not run
Z1177:Nwd2 UTSW 5 63804984 missense not run
Z1177:Nwd2 UTSW 5 63807326 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTACGACAAACAACACCTTGCTG -3'
(R):5'- CATGACCATCTCTTGAGCTGTGTCC -3'

Sequencing Primer
(F):5'- CACCTTGCTGATTTACGACAATG -3'
(R):5'- ATCTCTTGAGCTGTGTCCAAGATG -3'
Posted On2013-05-23