Incidental Mutation 'R5292:Spink5'
ID405225
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
MMRRC Submission 042875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5292 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44006454 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 628 (P628Q)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect probably benign
Transcript: ENSMUST00000069245
AA Change: P628Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: P628Q

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A G 8: 24,864,451 V641A possibly damaging Het
Akap2 T G 4: 57,855,356 S471R probably damaging Het
Apob A T 12: 8,005,912 M1465L probably benign Het
Astn1 T C 1: 158,580,363 probably null Het
Bend7 G A 2: 4,763,241 R336Q probably damaging Het
Col22a1 T C 15: 71,970,336 Y433C probably damaging Het
Crtc3 T C 7: 80,618,610 T154A possibly damaging Het
Dcc T C 18: 71,306,088 Y1241C probably damaging Het
Depdc1b T C 13: 108,373,842 V296A probably damaging Het
E430018J23Rik T C 7: 127,392,487 D97G possibly damaging Het
Gata3 A G 2: 9,868,874 S270P probably damaging Het
Gcm1 T C 9: 78,061,426 F136S probably damaging Het
Gfpt1 A G 6: 87,076,255 probably null Het
Gm5174 G T 10: 86,656,698 noncoding transcript Het
Hhipl1 A G 12: 108,327,778 T648A probably benign Het
Hr C A 14: 70,571,992 Q1177K probably damaging Het
Hrnr T C 3: 93,331,892 S3146P unknown Het
Igkv10-94 C T 6: 68,704,598 G86E probably damaging Het
Krt80 G A 15: 101,352,185 R222W probably damaging Het
Lrch3 T C 16: 32,975,807 Y354H probably damaging Het
Olfr1133 T A 2: 87,645,995 N43Y probably damaging Het
Olfr1510 A T 14: 52,410,445 N142K possibly damaging Het
Olfr401 T A 11: 74,122,051 F254Y probably damaging Het
Osbpl7 A G 11: 97,067,953 D932G probably benign Het
Palmd T C 3: 116,923,744 E368G probably benign Het
Peg3 T A 7: 6,708,260 D1321V probably damaging Het
Pkhd1l1 A T 15: 44,529,566 I1766F probably damaging Het
Polq A G 16: 37,061,383 E1303G probably damaging Het
Ppie A G 4: 123,139,908 Y9H probably damaging Het
Ptprz1 A G 6: 23,002,582 N1557S probably benign Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rtn4 T C 11: 29,707,924 F577L probably benign Het
Sacs A G 14: 61,211,983 Y3826C probably damaging Het
Slc32a1 A G 2: 158,611,387 D49G probably damaging Het
Slc37a2 A T 9: 37,239,157 C167* probably null Het
Slc5a1 G T 5: 33,158,241 V535F probably benign Het
Smoc2 A G 17: 14,336,573 K95E probably damaging Het
Smok3c A C 5: 138,065,184 Q311P probably damaging Het
Spint4 T C 2: 164,700,859 L124S probably benign Het
Stard9 A G 2: 120,699,145 K1961R probably benign Het
Synpo2 C A 3: 123,114,060 V536L possibly damaging Het
Trim24 A G 6: 37,903,604 K146E probably benign Het
Usp24 A G 4: 106,418,263 D2245G probably benign Het
Vars2 A G 17: 35,660,786 S81P probably damaging Het
Zfp39 T C 11: 58,900,589 T91A probably damaging Het
Zfp936 T A 7: 43,189,335 Y75* probably null Het
Zkscan5 G T 5: 145,218,641 C374F probably damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7396:Spink5 UTSW 18 43977655 missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
R7828:Spink5 UTSW 18 44010229 missense probably benign 0.15
R7836:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7880:Spink5 UTSW 18 43986326 missense probably benign 0.40
R7919:Spink5 UTSW 18 43999821 missense probably benign 0.00
R7963:Spink5 UTSW 18 43986326 missense probably benign 0.40
R8031:Spink5 UTSW 18 44010236 missense probably benign 0.07
Z1177:Spink5 UTSW 18 43996635 missense probably damaging 0.97
Z1177:Spink5 UTSW 18 43996697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGAATTCATCTCGGGC -3'
(R):5'- AATGCCAATGCTTTGACGG -3'

Sequencing Primer
(F):5'- CAGAATTCATCTCGGGCATTTTACG -3'
(R):5'- CCAATGCTTTGACGGGACAG -3'
Posted On2016-07-22