Incidental Mutation 'R5293:Akr7a5'
ID405241
Institutional Source Beutler Lab
Gene Symbol Akr7a5
Ensembl Gene ENSMUSG00000028743
Gene Namealdo-keto reductase family 7, member A5 (aflatoxin aldehyde reductase)
Synonyms0610025K21Rik, Afar
MMRRC Submission 042876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5293 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139310744-139318426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 139314206 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 142 (R142L)
Ref Sequence ENSEMBL: ENSMUSP00000073459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053862] [ENSMUST00000073787] [ENSMUST00000105801] [ENSMUST00000139840] [ENSMUST00000141007] [ENSMUST00000172747]
PDB Structure
MOUSE SUCCINIC SEMIALDEHYDE REDUCTASE, AKR7A5 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000053862
SMART Domains Protein: ENSMUSP00000059772
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073787
AA Change: R142L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000073459
Gene: ENSMUSG00000028743
AA Change: R142L

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
Pfam:Aldo_ket_red 48 356 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105801
SMART Domains Protein: ENSMUSP00000101427
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139840
SMART Domains Protein: ENSMUSP00000121362
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153645
Predicted Effect probably benign
Transcript: ENSMUST00000172747
SMART Domains Protein: ENSMUSP00000134464
Gene: ENSMUSG00000028744

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldo/keto reductase (AKR) superfamily and AKR7 family, which are involved in the detoxification of aldehydes and ketones. The AKR7 family consists of 3 genes that are present in a cluster on the p arm of chromosome 1. This protein, thought to be localized in the golgi, catalyzes the NADPH-dependent reduction of succinic semialdehyde to the endogenous neuromodulator, gamma-hydroxybutyrate. It may also function as a detoxication enzyme in the reduction of aflatoxin B1 and 2-carboxybenzaldehyde. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,810,706 V269A possibly damaging Het
Akap9 C T 5: 3,948,687 R19W probably damaging Het
Atp6v0a2 A T 5: 124,646,709 M311L probably benign Het
Atxn1 C T 13: 45,568,368 R17H probably damaging Het
Ccdc116 A T 16: 17,141,787 L346Q possibly damaging Het
Copg2 T A 6: 30,826,227 N261I probably damaging Het
Crtc2 A G 3: 90,263,564 E648G probably benign Het
Dnah10 A C 5: 124,791,787 K2334Q probably benign Het
Foxa2 T C 2: 148,044,002 T123A probably benign Het
Galnt6 A G 15: 100,703,501 V299A probably benign Het
Grip1 T C 10: 119,897,735 S26P probably damaging Het
Jkamp A G 12: 72,090,109 S84G probably benign Het
Kcnc1 A G 7: 46,397,811 H45R probably benign Het
Knl1 T C 2: 119,069,695 Y626H probably damaging Het
Mmp19 T A 10: 128,791,101 V16D probably damaging Het
Mrpl38 T C 11: 116,132,773 N280S probably benign Het
Myl7 T A 11: 5,898,521 probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,503,429 probably benign Het
Nlrp2 A C 7: 5,327,615 L594R probably damaging Het
Olfr1309 T G 2: 111,983,266 K269N probably damaging Het
Olfr131 T A 17: 38,082,240 H246L probably damaging Het
Olfr668 T C 7: 104,925,279 T162A probably benign Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,535,750 V2070A probably benign Het
Plcxd2 G T 16: 45,980,343 H173N probably damaging Het
Plec C G 15: 76,199,583 W26C probably benign Het
Psmc1 C T 12: 100,115,472 T111I probably benign Het
Rbfa T C 18: 80,192,766 E256G probably benign Het
Sh3d21 T A 4: 126,152,257 T173S probably benign Het
Slc41a3 T A 6: 90,626,444 V149E probably damaging Het
Sntg1 A G 1: 8,595,533 S186P probably damaging Het
Spag4 A G 2: 156,066,191 D29G probably benign Het
Spc25 A G 2: 69,202,652 V43A possibly damaging Het
Spen G A 4: 141,472,406 A2947V possibly damaging Het
Spta1 T C 1: 174,195,985 S653P probably damaging Het
Ssrp1 T A 2: 85,042,252 Y411* probably null Het
Synrg C T 11: 83,981,499 L149F probably damaging Het
Trappc11 G A 8: 47,493,342 A1085V possibly damaging Het
Ttn T C 2: 76,740,932 E18212G probably damaging Het
Wnk4 T G 11: 101,275,197 probably benign Het
Other mutations in Akr7a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Akr7a5 APN 4 139314269 missense probably damaging 1.00
IGL02469:Akr7a5 APN 4 139314181 missense probably damaging 1.00
IGL03155:Akr7a5 APN 4 139314526 nonsense probably null
R1403:Akr7a5 UTSW 4 139318123 missense probably damaging 0.99
R1403:Akr7a5 UTSW 4 139318123 missense probably damaging 0.99
R4288:Akr7a5 UTSW 4 139314104 missense probably benign 0.02
R4585:Akr7a5 UTSW 4 139310927 missense probably benign 0.09
R5067:Akr7a5 UTSW 4 139311022 missense probably damaging 1.00
R6296:Akr7a5 UTSW 4 139318221 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TTGCATGTCCAGTGAATAATTCTTAT -3'
(R):5'- GCCCAGAGAGCCTCACTG -3'

Sequencing Primer
(F):5'- TCGAACTCAGAGATCTGCCTG -3'
(R):5'- TCACTGTCCTGGCAGACTCAG -3'
Posted On2016-07-22