Mutagenetix > Incidental Mutations

Incidental Mutation 'R5293:Spen'

405242

Institutional Source

Beutler Lab

Gene Symbol

Spen

Ensembl Gene

ENSMUSG00000040761

Gene Name

spen family transcription repressor

Synonyms

Mint

MMRRC Submission

042876-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5293 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141467890-141538597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 141472406 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 2947 (A2947V)

Ref Sequence

ENSEMBL: ENSMUSP00000077925 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078886
AA Change: A2947V

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: A2947V

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	617	632	N/A	INTRINSIC
low complexity region	669	691	N/A	INTRINSIC
low complexity region	695	720	N/A	INTRINSIC
low complexity region	749	773	N/A	INTRINSIC
coiled coil region	800	825	N/A	INTRINSIC
low complexity region	830	841	N/A	INTRINSIC
internal_repeat_2	844	954	6.27e-5	PROSPERO
coiled coil region	1494	1522	N/A	INTRINSIC
low complexity region	1587	1627	N/A	INTRINSIC
low complexity region	1635	1641	N/A	INTRINSIC
low complexity region	1642	1671	N/A	INTRINSIC
low complexity region	1747	1758	N/A	INTRINSIC
low complexity region	1810	1823	N/A	INTRINSIC
low complexity region	1888	1903	N/A	INTRINSIC
low complexity region	1940	1955	N/A	INTRINSIC
low complexity region	2003	2012	N/A	INTRINSIC
internal_repeat_2	2015	2115	6.27e-5	PROSPERO
low complexity region	2127	2147	N/A	INTRINSIC
low complexity region	2169	2191	N/A	INTRINSIC
low complexity region	2207	2219	N/A	INTRINSIC
low complexity region	2304	2323	N/A	INTRINSIC
low complexity region	2332	2371	N/A	INTRINSIC
low complexity region	2396	2413	N/A	INTRINSIC
low complexity region	2518	2533	N/A	INTRINSIC
low complexity region	2545	2555	N/A	INTRINSIC
low complexity region	2696	2722	N/A	INTRINSIC
low complexity region	2931	2942	N/A	INTRINSIC
low complexity region	2994	3006	N/A	INTRINSIC
low complexity region	3192	3212	N/A	INTRINSIC
low complexity region	3299	3337	N/A	INTRINSIC
Pfam:SPOC	3465	3586	2.7e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105786
AA Change: A2970V

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: A2970V

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	692	714	N/A	INTRINSIC
low complexity region	718	743	N/A	INTRINSIC
low complexity region	772	796	N/A	INTRINSIC
coiled coil region	823	848	N/A	INTRINSIC
low complexity region	853	864	N/A	INTRINSIC
internal_repeat_2	867	977	8.58e-5	PROSPERO
coiled coil region	1517	1545	N/A	INTRINSIC
low complexity region	1610	1650	N/A	INTRINSIC
low complexity region	1658	1664	N/A	INTRINSIC
low complexity region	1665	1694	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1833	1846	N/A	INTRINSIC
low complexity region	1911	1926	N/A	INTRINSIC
low complexity region	1963	1978	N/A	INTRINSIC
low complexity region	2026	2035	N/A	INTRINSIC
internal_repeat_2	2038	2138	8.58e-5	PROSPERO
low complexity region	2150	2170	N/A	INTRINSIC
low complexity region	2192	2214	N/A	INTRINSIC
low complexity region	2230	2242	N/A	INTRINSIC
low complexity region	2327	2346	N/A	INTRINSIC
low complexity region	2355	2394	N/A	INTRINSIC
low complexity region	2419	2436	N/A	INTRINSIC
low complexity region	2541	2556	N/A	INTRINSIC
low complexity region	2568	2578	N/A	INTRINSIC
low complexity region	2719	2745	N/A	INTRINSIC
low complexity region	2954	2965	N/A	INTRINSIC
low complexity region	3017	3029	N/A	INTRINSIC
low complexity region	3215	3235	N/A	INTRINSIC
low complexity region	3322	3360	N/A	INTRINSIC
Pfam:SPOC	3488	3609	2.7e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142438

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147227

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam5	A	G	8: 24,810,706	V269A	possibly damaging	Het
Akap9	C	T	5: 3,948,687	R19W	probably damaging	Het
Akr7a5	G	T	4: 139,314,206	R142L	probably benign	Het
Atp6v0a2	A	T	5: 124,646,709	M311L	probably benign	Het
Atxn1	C	T	13: 45,568,368	R17H	probably damaging	Het
Ccdc116	A	T	16: 17,141,787	L346Q	possibly damaging	Het
Copg2	T	A	6: 30,826,227	N261I	probably damaging	Het
Crtc2	A	G	3: 90,263,564	E648G	probably benign	Het
Dnah10	A	C	5: 124,791,787	K2334Q	probably benign	Het
Foxa2	T	C	2: 148,044,002	T123A	probably benign	Het
Galnt6	A	G	15: 100,703,501	V299A	probably benign	Het
Grip1	T	C	10: 119,897,735	S26P	probably damaging	Het
Jkamp	A	G	12: 72,090,109	S84G	probably benign	Het
Kcnc1	A	G	7: 46,397,811	H45R	probably benign	Het
Knl1	T	C	2: 119,069,695	Y626H	probably damaging	Het
Mmp19	T	A	10: 128,791,101	V16D	probably damaging	Het
Mrpl38	T	C	11: 116,132,773	N280S	probably benign	Het
Myl7	T	A	11: 5,898,521		probably benign	Het
Ngef	CCCTCCTCCTCCTCCTCCTCCTCCTC	CCCTCCTCCTCCTCCTCCTCCTC	1: 87,503,429		probably benign	Het
Nlrp2	A	C	7: 5,327,615	L594R	probably damaging	Het
Olfr1309	T	G	2: 111,983,266	K269N	probably damaging	Het
Olfr131	T	A	17: 38,082,240	H246L	probably damaging	Het
Olfr668	T	C	7: 104,925,279	T162A	probably benign	Het
Pkhd1	T	C	1: 20,509,076	E1802G	possibly damaging	Het
Pkhd1l1	T	C	15: 44,535,750	V2070A	probably benign	Het
Plcxd2	G	T	16: 45,980,343	H173N	probably damaging	Het
Plec	C	G	15: 76,199,583	W26C	probably benign	Het
Psmc1	C	T	12: 100,115,472	T111I	probably benign	Het
Rbfa	T	C	18: 80,192,766	E256G	probably benign	Het
Sh3d21	T	A	4: 126,152,257	T173S	probably benign	Het
Slc41a3	T	A	6: 90,626,444	V149E	probably damaging	Het
Sntg1	A	G	1: 8,595,533	S186P	probably damaging	Het
Spag4	A	G	2: 156,066,191	D29G	probably benign	Het
Spc25	A	G	2: 69,202,652	V43A	possibly damaging	Het
Spta1	T	C	1: 174,195,985	S653P	probably damaging	Het
Ssrp1	T	A	2: 85,042,252	Y411*	probably null	Het
Synrg	C	T	11: 83,981,499	L149F	probably damaging	Het
Trappc11	G	A	8: 47,493,342	A1085V	possibly damaging	Het
Ttn	T	C	2: 76,740,932	E18212G	probably damaging	Het
Wnk4	T	G	11: 101,275,197		probably benign	Het

Other mutations in Spen

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Spen	APN	4	141489901	missense	unknown
IGL01357:Spen	APN	4	141517113	missense	unknown
IGL02184:Spen	APN	4	141487606	missense	unknown
IGL02226:Spen	APN	4	141478146	missense	unknown
IGL02321:Spen	APN	4	141517130	missense	unknown
IGL02350:Spen	APN	4	141477579	missense	unknown
IGL02357:Spen	APN	4	141477579	missense	unknown
IGL02627:Spen	APN	4	141473015	missense	probably damaging	0.99
IGL02683:Spen	APN	4	141471645	missense	probably benign	0.06
IGL02945:Spen	APN	4	141494313	missense	unknown
IGL02950:Spen	APN	4	141469508	missense	probably damaging	1.00
IGL03008:Spen	APN	4	141476137	missense	possibly damaging	0.70
IGL03019:Spen	APN	4	141478916	missense	unknown
IGL03038:Spen	APN	4	141538239	missense	unknown
IGL03334:Spen	APN	4	141469969	missense	probably damaging	1.00
R0105:Spen	UTSW	4	141469810	splice site	probably benign
R0268:Spen	UTSW	4	141477557	missense	unknown
R0359:Spen	UTSW	4	141516870	missense	unknown
R0394:Spen	UTSW	4	141474203	missense	probably benign	0.03
R0423:Spen	UTSW	4	141479336	missense	unknown
R0433:Spen	UTSW	4	141483758	missense	unknown
R0462:Spen	UTSW	4	141473651	missense	probably damaging	1.00
R0687:Spen	UTSW	4	141488028	missense	unknown
R0699:Spen	UTSW	4	141474391	missense	possibly damaging	0.72
R0865:Spen	UTSW	4	141471870	missense	probably benign	0.11
R0918:Spen	UTSW	4	141485564	missense	unknown
R1034:Spen	UTSW	4	141475752	missense	probably benign	0.33
R1341:Spen	UTSW	4	141469400	missense	possibly damaging	0.78
R1401:Spen	UTSW	4	141471821	missense	probably damaging	0.98
R1509:Spen	UTSW	4	141475635	missense	probably benign	0.00
R1509:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R1561:Spen	UTSW	4	141472383	nonsense	probably null
R1589:Spen	UTSW	4	141488024	missense	unknown
R1640:Spen	UTSW	4	141468943	missense	probably damaging	0.98
R1758:Spen	UTSW	4	141476375	missense	unknown
R1764:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R1824:Spen	UTSW	4	141472785	missense	probably damaging	1.00
R1899:Spen	UTSW	4	141470343	missense	probably benign	0.17
R1916:Spen	UTSW	4	141472598	missense	probably damaging	1.00
R2011:Spen	UTSW	4	141473329	missense	probably damaging	1.00
R2295:Spen	UTSW	4	141477273	missense	unknown
R2379:Spen	UTSW	4	141516927	missense	unknown
R2404:Spen	UTSW	4	141477905	missense	unknown
R3719:Spen	UTSW	4	141517183	missense	unknown
R3889:Spen	UTSW	4	141477881	missense	unknown
R3945:Spen	UTSW	4	141477353	missense	unknown
R4227:Spen	UTSW	4	141522147	missense	unknown
R4326:Spen	UTSW	4	141477372	missense	unknown
R4382:Spen	UTSW	4	141473139	missense	possibly damaging	0.88
R4542:Spen	UTSW	4	141476786	missense	unknown
R4757:Spen	UTSW	4	141473079	nonsense	probably null
R4771:Spen	UTSW	4	141472596	missense	probably benign	0.14
R5072:Spen	UTSW	4	141522302	missense	unknown
R5121:Spen	UTSW	4	141476099	missense	probably benign	0.00
R5176:Spen	UTSW	4	141476276	missense	unknown
R5290:Spen	UTSW	4	141473816	missense	probably damaging	1.00
R5291:Spen	UTSW	4	141488079	missense	unknown
R5347:Spen	UTSW	4	141471485	missense	probably benign	0.26
R5511:Spen	UTSW	4	141475064	missense	possibly damaging	0.86
R5511:Spen	UTSW	4	141516838	missense	unknown
R5772:Spen	UTSW	4	141478184	missense	unknown
R5834:Spen	UTSW	4	141471843	missense	possibly damaging	0.63
R5858:Spen	UTSW	4	141473871	missense	probably benign	0.05
R6214:Spen	UTSW	4	141479112	missense	unknown
R6232:Spen	UTSW	4	141517022	missense	unknown
R6345:Spen	UTSW	4	141471633	missense	possibly damaging	0.86
R6419:Spen	UTSW	4	141476310	missense	unknown
R6455:Spen	UTSW	4	141475509	missense	probably damaging	0.97
R6979:Spen	UTSW	4	141478063	missense	unknown
R6994:Spen	UTSW	4	141493459	missense	unknown
R7018:Spen	UTSW	4	141493444	missense	unknown
R7040:Spen	UTSW	4	141494382	missense	unknown
R7127:Spen	UTSW	4	141476108	missense	possibly damaging	0.53
R7218:Spen	UTSW	4	141472650	missense	possibly damaging	0.54
R7234:Spen	UTSW	4	141479135	missense	unknown
R7316:Spen	UTSW	4	141477054	missense	unknown
R7350:Spen	UTSW	4	141479385	missense	unknown
R7356:Spen	UTSW	4	141471924	nonsense	probably null
R7400:Spen	UTSW	4	141473741	missense	probably damaging	1.00
R7470:Spen	UTSW	4	141479294	missense	unknown
R7698:Spen	UTSW	4	141472845	missense	probably damaging	1.00
R7858:Spen	UTSW	4	141488131	splice site	probably null
R8033:Spen	UTSW	4	141471746	missense	probably benign	0.03
R8064:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R8159:Spen	UTSW	4	141475003	missense	possibly damaging	0.53
R8187:Spen	UTSW	4	141472905	missense	possibly damaging	0.93
R8463:Spen	UTSW	4	141522279	missense	unknown
R8557:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8558:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8672:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8673:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8674:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8735:Spen	UTSW	4	141469818	missense	probably benign	0.32
T0722:Spen	UTSW	4	141474353	missense	probably benign	0.33
T0975:Spen	UTSW	4	141474353	missense	probably benign	0.33
Z1088:Spen	UTSW	4	141477976	missense	unknown
Z1088:Spen	UTSW	4	141477977	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATGCTGGAGATGAACTGCG -3'
(R):5'- ACAGTGAAGGTTCTCACCCAG -3'

Sequencing Primer
(F):5'- AGATGAACTGCGGCACC -3'
(R):5'- AAGGTTCTCACCCAGGGCATC -3'

Posted On

2016-07-22