Incidental Mutation 'R5293:Nlrp2'
ID 405248
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Pan1, Nbs1, E330007A02Rik, PYPAF2, Nalp2
MMRRC Submission 042876-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5293 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 5301546-5354034 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 5330614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 594 (L594R)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect probably damaging
Transcript: ENSMUST00000045022
AA Change: L594R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: L594R

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 25,300,722 (GRCm39) V269A possibly damaging Het
Akap9 C T 5: 3,998,687 (GRCm39) R19W probably damaging Het
Akr7a5 G T 4: 139,041,517 (GRCm39) R142L probably benign Het
Atp6v0a2 A T 5: 124,784,649 (GRCm39) M311L probably benign Het
Atxn1 C T 13: 45,721,844 (GRCm39) R17H probably damaging Het
Ccdc116 A T 16: 16,959,651 (GRCm39) L346Q possibly damaging Het
Copg2 T A 6: 30,803,162 (GRCm39) N261I probably damaging Het
Crtc2 A G 3: 90,170,871 (GRCm39) E648G probably benign Het
Dnah10 A C 5: 124,868,851 (GRCm39) K2334Q probably benign Het
Foxa2 T C 2: 147,885,922 (GRCm39) T123A probably benign Het
Galnt6 A G 15: 100,601,382 (GRCm39) V299A probably benign Het
Grip1 T C 10: 119,733,640 (GRCm39) S26P probably damaging Het
Jkamp A G 12: 72,136,883 (GRCm39) S84G probably benign Het
Kcnc1 A G 7: 46,047,235 (GRCm39) H45R probably benign Het
Knl1 T C 2: 118,900,176 (GRCm39) Y626H probably damaging Het
Mmp19 T A 10: 128,626,970 (GRCm39) V16D probably damaging Het
Mrpl38 T C 11: 116,023,599 (GRCm39) N280S probably benign Het
Myl7 T A 11: 5,848,521 (GRCm39) probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,431,151 (GRCm39) probably benign Het
Or2y3 T A 17: 38,393,131 (GRCm39) H246L probably damaging Het
Or4f15 T G 2: 111,813,611 (GRCm39) K269N probably damaging Het
Or52n2c T C 7: 104,574,486 (GRCm39) T162A probably benign Het
Pkhd1 T C 1: 20,579,300 (GRCm39) E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,399,146 (GRCm39) V2070A probably benign Het
Plcxd2 G T 16: 45,800,706 (GRCm39) H173N probably damaging Het
Plec C G 15: 76,083,783 (GRCm39) W26C probably benign Het
Psmc1 C T 12: 100,081,731 (GRCm39) T111I probably benign Het
Rbfa T C 18: 80,235,981 (GRCm39) E256G probably benign Het
Sh3d21 T A 4: 126,046,050 (GRCm39) T173S probably benign Het
Slc41a3 T A 6: 90,603,426 (GRCm39) V149E probably damaging Het
Sntg1 A G 1: 8,665,757 (GRCm39) S186P probably damaging Het
Spag4 A G 2: 155,908,111 (GRCm39) D29G probably benign Het
Spc25 A G 2: 69,032,996 (GRCm39) V43A possibly damaging Het
Spen G A 4: 141,199,717 (GRCm39) A2947V possibly damaging Het
Spta1 T C 1: 174,023,551 (GRCm39) S653P probably damaging Het
Ssrp1 T A 2: 84,872,596 (GRCm39) Y411* probably null Het
Synrg C T 11: 83,872,325 (GRCm39) L149F probably damaging Het
Trappc11 G A 8: 47,946,377 (GRCm39) A1085V possibly damaging Het
Ttn T C 2: 76,571,276 (GRCm39) E18212G probably damaging Het
Wnk4 T G 11: 101,166,023 (GRCm39) probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5,340,547 (GRCm39) missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5,331,251 (GRCm39) missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5,322,238 (GRCm39) missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5,320,491 (GRCm39) missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5,340,769 (GRCm39) missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5,331,034 (GRCm39) missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5,330,822 (GRCm39) missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5,340,598 (GRCm39) missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5,331,809 (GRCm39) missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5,338,566 (GRCm39) critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5,330,551 (GRCm39) nonsense probably null
IGL02803:Nlrp2 APN 7 5,331,317 (GRCm39) missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5,304,024 (GRCm39) missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5,320,482 (GRCm39) missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5,325,333 (GRCm39) unclassified probably benign
R0079:Nlrp2 UTSW 7 5,330,729 (GRCm39) missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5,325,417 (GRCm39) missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5,311,769 (GRCm39) missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5,331,328 (GRCm39) missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5,331,108 (GRCm39) missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5,331,544 (GRCm39) missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5,320,629 (GRCm39) missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5,322,221 (GRCm39) missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5,331,430 (GRCm39) missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5,330,490 (GRCm39) missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5,332,014 (GRCm39) splice site probably benign
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5,303,950 (GRCm39) missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5,311,724 (GRCm39) missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5,330,715 (GRCm39) nonsense probably null
R1942:Nlrp2 UTSW 7 5,325,447 (GRCm39) missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5,330,737 (GRCm39) missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5,328,005 (GRCm39) missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5,328,041 (GRCm39) missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5,322,237 (GRCm39) missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5,338,597 (GRCm39) missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5,331,128 (GRCm39) missense probably benign
R2334:Nlrp2 UTSW 7 5,340,534 (GRCm39) missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5,330,747 (GRCm39) missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5,322,286 (GRCm39) missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5,330,551 (GRCm39) nonsense probably null
R4021:Nlrp2 UTSW 7 5,328,011 (GRCm39) missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5,328,055 (GRCm39) missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5,322,188 (GRCm39) missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5,331,023 (GRCm39) missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5,331,950 (GRCm39) missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5,301,858 (GRCm39) missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5,331,076 (GRCm39) missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5,328,007 (GRCm39) missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5,331,118 (GRCm39) missense probably benign
R5390:Nlrp2 UTSW 7 5,303,908 (GRCm39) missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5,325,380 (GRCm39) missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5,327,902 (GRCm39) splice site probably null
R6173:Nlrp2 UTSW 7 5,340,808 (GRCm39) missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5,320,554 (GRCm39) missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5,340,760 (GRCm39) missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5,303,925 (GRCm39) missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5,328,040 (GRCm39) nonsense probably null
R6814:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5,311,709 (GRCm39) missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5,331,228 (GRCm39) nonsense probably null
R7028:Nlrp2 UTSW 7 5,331,571 (GRCm39) missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5,331,616 (GRCm39) missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5,320,533 (GRCm39) missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5,311,644 (GRCm39) missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5,330,627 (GRCm39) missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5,320,468 (GRCm39) critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5,322,167 (GRCm39) missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5,330,498 (GRCm39) missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5,331,527 (GRCm39) missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5,330,650 (GRCm39) missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5,320,494 (GRCm39) missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5,330,548 (GRCm39) missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5,330,887 (GRCm39) missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5,327,978 (GRCm39) missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5,325,457 (GRCm39) missense probably null 0.00
R9038:Nlrp2 UTSW 7 5,330,478 (GRCm39) missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5,330,572 (GRCm39) missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5,304,052 (GRCm39) missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5,322,215 (GRCm39) missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5,330,641 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTAGTGCAGCAACATTCTCTG -3'
(R):5'- CATGCTTTCAAGGGAAGCAAG -3'

Sequencing Primer
(F):5'- CTAGTGCAGCAACATTCTCTGGAAAG -3'
(R):5'- AAAAACCCTGACCTGTCTGG -3'
Posted On 2016-07-22