Incidental Mutation 'R5293:Kcnc1'
ID405249
Institutional Source Beutler Lab
Gene Symbol Kcnc1
Ensembl Gene ENSMUSG00000058975
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 1
SynonymsKv3.1, C230009H10Rik, Kcr2-1, KShIIIB, NGK2, KV4, Shaw
MMRRC Submission 042876-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R5293 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46396497-46438704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46397811 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 45 (H45R)
Ref Sequence ENSEMBL: ENSMUSP00000124938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025202] [ENSMUST00000160433]
Predicted Effect probably benign
Transcript: ENSMUST00000025202
AA Change: H45R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000025202
Gene: ENSMUSG00000058975
AA Change: H45R

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 247 435 2.8e-34 PFAM
Pfam:Ion_trans_2 346 440 1.5e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160433
AA Change: H45R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000124938
Gene: ENSMUSG00000058975
AA Change: H45R

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 189 447 6.9e-47 PFAM
Pfam:Ion_trans_2 347 440 1.4e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both "b" and "alpha", while the shorter isoform has been called both "a" and "beta" (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,810,706 V269A possibly damaging Het
Akap9 C T 5: 3,948,687 R19W probably damaging Het
Akr7a5 G T 4: 139,314,206 R142L probably benign Het
Atp6v0a2 A T 5: 124,646,709 M311L probably benign Het
Atxn1 C T 13: 45,568,368 R17H probably damaging Het
Ccdc116 A T 16: 17,141,787 L346Q possibly damaging Het
Copg2 T A 6: 30,826,227 N261I probably damaging Het
Crtc2 A G 3: 90,263,564 E648G probably benign Het
Dnah10 A C 5: 124,791,787 K2334Q probably benign Het
Foxa2 T C 2: 148,044,002 T123A probably benign Het
Galnt6 A G 15: 100,703,501 V299A probably benign Het
Grip1 T C 10: 119,897,735 S26P probably damaging Het
Jkamp A G 12: 72,090,109 S84G probably benign Het
Knl1 T C 2: 119,069,695 Y626H probably damaging Het
Mmp19 T A 10: 128,791,101 V16D probably damaging Het
Mrpl38 T C 11: 116,132,773 N280S probably benign Het
Myl7 T A 11: 5,898,521 probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,503,429 probably benign Het
Nlrp2 A C 7: 5,327,615 L594R probably damaging Het
Olfr1309 T G 2: 111,983,266 K269N probably damaging Het
Olfr131 T A 17: 38,082,240 H246L probably damaging Het
Olfr668 T C 7: 104,925,279 T162A probably benign Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,535,750 V2070A probably benign Het
Plcxd2 G T 16: 45,980,343 H173N probably damaging Het
Plec C G 15: 76,199,583 W26C probably benign Het
Psmc1 C T 12: 100,115,472 T111I probably benign Het
Rbfa T C 18: 80,192,766 E256G probably benign Het
Sh3d21 T A 4: 126,152,257 T173S probably benign Het
Slc41a3 T A 6: 90,626,444 V149E probably damaging Het
Sntg1 A G 1: 8,595,533 S186P probably damaging Het
Spag4 A G 2: 156,066,191 D29G probably benign Het
Spc25 A G 2: 69,202,652 V43A possibly damaging Het
Spen G A 4: 141,472,406 A2947V possibly damaging Het
Spta1 T C 1: 174,195,985 S653P probably damaging Het
Ssrp1 T A 2: 85,042,252 Y411* probably null Het
Synrg C T 11: 83,981,499 L149F probably damaging Het
Trappc11 G A 8: 47,493,342 A1085V possibly damaging Het
Ttn T C 2: 76,740,932 E18212G probably damaging Het
Wnk4 T G 11: 101,275,197 probably benign Het
Other mutations in Kcnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Kcnc1 APN 7 46428099 missense possibly damaging 0.95
IGL01860:Kcnc1 APN 7 46428130 missense probably damaging 1.00
IGL02075:Kcnc1 APN 7 46427973 missense probably damaging 1.00
IGL02478:Kcnc1 APN 7 46435169 missense probably benign 0.18
Evanescent UTSW 7 46427959 missense probably damaging 1.00
Subtilis UTSW 7 46427821 missense probably damaging 1.00
wispy UTSW 7 46427397 missense probably damaging 1.00
R1438:Kcnc1 UTSW 7 46428267 missense possibly damaging 0.81
R1487:Kcnc1 UTSW 7 46397874 missense possibly damaging 0.88
R1487:Kcnc1 UTSW 7 46435348 critical splice donor site probably null
R1595:Kcnc1 UTSW 7 46427586 missense probably benign 0.03
R2273:Kcnc1 UTSW 7 46427802 missense probably damaging 1.00
R2345:Kcnc1 UTSW 7 46397946 missense probably damaging 1.00
R4126:Kcnc1 UTSW 7 46398002 missense probably damaging 0.98
R4387:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4388:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4508:Kcnc1 UTSW 7 46428288 missense probably benign 0.15
R4688:Kcnc1 UTSW 7 46397835 missense probably benign 0.01
R4784:Kcnc1 UTSW 7 46437287 missense probably benign 0.00
R5993:Kcnc1 UTSW 7 46427532 missense probably damaging 1.00
R6296:Kcnc1 UTSW 7 46435316 missense probably benign 0.00
R6512:Kcnc1 UTSW 7 46427397 missense probably damaging 1.00
R6678:Kcnc1 UTSW 7 46397805 missense probably benign 0.30
R6801:Kcnc1 UTSW 7 46435292 missense probably damaging 0.99
R7232:Kcnc1 UTSW 7 46427959 missense probably damaging 1.00
R7886:Kcnc1 UTSW 7 46427621 missense probably damaging 1.00
R7899:Kcnc1 UTSW 7 46427821 missense probably damaging 1.00
R7998:Kcnc1 UTSW 7 46397799 missense probably benign 0.01
X0022:Kcnc1 UTSW 7 46435240 missense probably benign
X0054:Kcnc1 UTSW 7 46397892 missense probably damaging 1.00
Y5406:Kcnc1 UTSW 7 46427379 missense probably benign 0.00
Z1177:Kcnc1 UTSW 7 46397852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCGCCTTAAAGACCCTAG -3'
(R):5'- GATAGGTCATCCAGCAGCAG -3'

Sequencing Primer
(F):5'- GCCTTAAAGACCCTAGGGAGC -3'
(R):5'- TCATCCAGCAGCAGGGCTC -3'
Posted On2016-07-22