Incidental Mutation 'R5293:Adam5'
ID405252
Institutional Source Beutler Lab
Gene Symbol Adam5
Ensembl Gene ENSMUSG00000031554
Gene Namea disintegrin and metallopeptidase domain 5
SynonymstMDCII
MMRRC Submission 042876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5293 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24727093-24824369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24810706 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 269 (V269A)
Ref Sequence ENSEMBL: ENSMUSP00000147290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050300] [ENSMUST00000118419] [ENSMUST00000209935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050300
AA Change: V269A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554
AA Change: V269A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118419
AA Change: V269A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112422
Gene: ENSMUSG00000031554
AA Change: V269A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 4.7e-30 PFAM
Pfam:Reprolysin 185 378 7.9e-56 PFAM
DISIN 397 474 1.78e-39 SMART
ACR 475 618 2.06e-55 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect unknown
Transcript: ENSMUST00000132180
AA Change: V186A
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554
AA Change: V186A

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209935
AA Change: V269A

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 C T 5: 3,948,687 R19W probably damaging Het
Akr7a5 G T 4: 139,314,206 R142L probably benign Het
Atp6v0a2 A T 5: 124,646,709 M311L probably benign Het
Atxn1 C T 13: 45,568,368 R17H probably damaging Het
Ccdc116 A T 16: 17,141,787 L346Q possibly damaging Het
Copg2 T A 6: 30,826,227 N261I probably damaging Het
Crtc2 A G 3: 90,263,564 E648G probably benign Het
Dnah10 A C 5: 124,791,787 K2334Q probably benign Het
Foxa2 T C 2: 148,044,002 T123A probably benign Het
Galnt6 A G 15: 100,703,501 V299A probably benign Het
Grip1 T C 10: 119,897,735 S26P probably damaging Het
Jkamp A G 12: 72,090,109 S84G probably benign Het
Kcnc1 A G 7: 46,397,811 H45R probably benign Het
Knl1 T C 2: 119,069,695 Y626H probably damaging Het
Mmp19 T A 10: 128,791,101 V16D probably damaging Het
Mrpl38 T C 11: 116,132,773 N280S probably benign Het
Myl7 T A 11: 5,898,521 probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,503,429 probably benign Het
Nlrp2 A C 7: 5,327,615 L594R probably damaging Het
Olfr1309 T G 2: 111,983,266 K269N probably damaging Het
Olfr131 T A 17: 38,082,240 H246L probably damaging Het
Olfr668 T C 7: 104,925,279 T162A probably benign Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,535,750 V2070A probably benign Het
Plcxd2 G T 16: 45,980,343 H173N probably damaging Het
Plec C G 15: 76,199,583 W26C probably benign Het
Psmc1 C T 12: 100,115,472 T111I probably benign Het
Rbfa T C 18: 80,192,766 E256G probably benign Het
Sh3d21 T A 4: 126,152,257 T173S probably benign Het
Slc41a3 T A 6: 90,626,444 V149E probably damaging Het
Sntg1 A G 1: 8,595,533 S186P probably damaging Het
Spag4 A G 2: 156,066,191 D29G probably benign Het
Spc25 A G 2: 69,202,652 V43A possibly damaging Het
Spen G A 4: 141,472,406 A2947V possibly damaging Het
Spta1 T C 1: 174,195,985 S653P probably damaging Het
Ssrp1 T A 2: 85,042,252 Y411* probably null Het
Synrg C T 11: 83,981,499 L149F probably damaging Het
Trappc11 G A 8: 47,493,342 A1085V possibly damaging Het
Ttn T C 2: 76,740,932 E18212G probably damaging Het
Wnk4 T G 11: 101,275,197 probably benign Het
Other mutations in Adam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Adam5 APN 8 24818742 missense probably benign 0.18
IGL01285:Adam5 APN 8 24781594 missense probably benign 0.02
IGL01310:Adam5 APN 8 24742134 intron probably benign
IGL01510:Adam5 APN 8 24804465 missense probably damaging 1.00
IGL01570:Adam5 APN 8 24810823 missense probably damaging 1.00
IGL02017:Adam5 APN 8 24781759 missense probably benign 0.38
IGL02191:Adam5 APN 8 24812423 nonsense probably null
IGL02397:Adam5 APN 8 24744133 intron probably benign
IGL02488:Adam5 APN 8 24792006 missense probably damaging 0.98
IGL02490:Adam5 APN 8 24781704 nonsense probably null
IGL02499:Adam5 APN 8 24781565 critical splice donor site probably null
IGL02539:Adam5 APN 8 24786213 nonsense probably null
IGL02590:Adam5 APN 8 24744135 intron probably benign
IGL02677:Adam5 APN 8 24812379 splice site probably benign
IGL02679:Adam5 APN 8 24806526 missense probably damaging 1.00
IGL02982:Adam5 APN 8 24804431 missense probably benign 0.02
IGL03146:Adam5 APN 8 24804503 missense probably damaging 0.98
IGL03162:Adam5 APN 8 24781604 missense probably benign 0.30
IGL03284:Adam5 APN 8 24786338 splice site probably benign
R0081:Adam5 UTSW 8 24781687 missense probably damaging 1.00
R0377:Adam5 UTSW 8 24747541 missense probably benign 0.08
R0398:Adam5 UTSW 8 24813432 missense probably benign 0.17
R0771:Adam5 UTSW 8 24786299 missense probably benign 0.04
R0925:Adam5 UTSW 8 24812425 missense probably benign 0.09
R1547:Adam5 UTSW 8 24810713 missense probably benign 0.10
R1985:Adam5 UTSW 8 24746739 missense probably benign 0.01
R2115:Adam5 UTSW 8 24744145 intron probably benign
R2125:Adam5 UTSW 8 24815118 missense probably damaging 1.00
R2144:Adam5 UTSW 8 24815480 missense probably benign 0.14
R3151:Adam5 UTSW 8 24781631 missense probably damaging 0.99
R3612:Adam5 UTSW 8 24818089 splice site probably benign
R3844:Adam5 UTSW 8 24813410 missense probably benign 0.12
R3873:Adam5 UTSW 8 24815109 missense probably benign 0.02
R4514:Adam5 UTSW 8 24818136 missense probably damaging 1.00
R4843:Adam5 UTSW 8 24813536 missense probably damaging 1.00
R4866:Adam5 UTSW 8 24742156 splice site probably null
R4866:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4900:Adam5 UTSW 8 24742156 splice site probably null
R4900:Adam5 UTSW 8 24781603 missense probably damaging 0.98
R4903:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R4936:Adam5 UTSW 8 24786271 missense probably damaging 1.00
R4964:Adam5 UTSW 8 24786232 missense probably damaging 1.00
R5259:Adam5 UTSW 8 24810834 missense possibly damaging 0.90
R5724:Adam5 UTSW 8 24804495 nonsense probably null
R5859:Adam5 UTSW 8 24813461 missense probably benign
R6004:Adam5 UTSW 8 24781669 missense probably benign 0.04
R6175:Adam5 UTSW 8 24786151 missense probably benign 0.00
R6539:Adam5 UTSW 8 24782600 missense possibly damaging 0.85
R6994:Adam5 UTSW 8 24786246 nonsense probably null
R6996:Adam5 UTSW 8 24806501 missense probably damaging 1.00
R7009:Adam5 UTSW 8 24806438 missense probably benign 0.00
R7115:Adam5 UTSW 8 24781696 missense possibly damaging 0.69
R7127:Adam5 UTSW 8 24810781 missense probably damaging 1.00
R7469:Adam5 UTSW 8 24815525 missense probably benign 0.45
R7780:Adam5 UTSW 8 24804416 missense possibly damaging 0.49
R8027:Adam5 UTSW 8 24782558 missense probably damaging 1.00
R8069:Adam5 UTSW 8 24813525 missense probably damaging 1.00
R8138:Adam5 UTSW 8 24781762 missense probably damaging 1.00
R8305:Adam5 UTSW 8 24810703 missense possibly damaging 0.93
R8359:Adam5 UTSW 8 24806486 missense probably damaging 1.00
R8480:Adam5 UTSW 8 24804459 nonsense probably null
R8743:Adam5 UTSW 8 24786248 missense probably damaging 1.00
X0019:Adam5 UTSW 8 24812443 missense probably benign 0.00
X0022:Adam5 UTSW 8 24813563 critical splice acceptor site probably null
X0027:Adam5 UTSW 8 24818772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTGCTATCCATTTATCACTAAG -3'
(R):5'- AGCCTCTTTGTAACCTGAAATAACC -3'

Sequencing Primer
(F):5'- GCTATCCATTTATCACTAAGAGTCAG -3'
(R):5'- GTGTTTCAAGTGATGCTCAAAATTAG -3'
Posted On2016-07-22