Incidental Mutation 'R5293:Grip1'
ID405254
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Nameglutamate receptor interacting protein 1
Synonymseb
MMRRC Submission 042876-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5293 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location119453830-120087261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119897735 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 26 (S26P)
Ref Sequence ENSEMBL: ENSMUSP00000122323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041962
AA Change: S27P

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813
AA Change: S27P

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077871
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105262
AA Change: S26P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813
AA Change: S26P

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138410
AA Change: S26P

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: S26P

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139352
Predicted Effect probably benign
Transcript: ENSMUST00000144825
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144959
AA Change: S26P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: S26P

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147356
AA Change: S27P

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: S27P

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147454
AA Change: S26P

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: S26P

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147598
Predicted Effect possibly damaging
Transcript: ENSMUST00000148954
AA Change: S26P

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813
AA Change: S26P

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,810,706 V269A possibly damaging Het
Akap9 C T 5: 3,948,687 R19W probably damaging Het
Akr7a5 G T 4: 139,314,206 R142L probably benign Het
Atp6v0a2 A T 5: 124,646,709 M311L probably benign Het
Atxn1 C T 13: 45,568,368 R17H probably damaging Het
Ccdc116 A T 16: 17,141,787 L346Q possibly damaging Het
Copg2 T A 6: 30,826,227 N261I probably damaging Het
Crtc2 A G 3: 90,263,564 E648G probably benign Het
Dnah10 A C 5: 124,791,787 K2334Q probably benign Het
Foxa2 T C 2: 148,044,002 T123A probably benign Het
Galnt6 A G 15: 100,703,501 V299A probably benign Het
Jkamp A G 12: 72,090,109 S84G probably benign Het
Kcnc1 A G 7: 46,397,811 H45R probably benign Het
Knl1 T C 2: 119,069,695 Y626H probably damaging Het
Mmp19 T A 10: 128,791,101 V16D probably damaging Het
Mrpl38 T C 11: 116,132,773 N280S probably benign Het
Myl7 T A 11: 5,898,521 probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,503,429 probably benign Het
Nlrp2 A C 7: 5,327,615 L594R probably damaging Het
Olfr1309 T G 2: 111,983,266 K269N probably damaging Het
Olfr131 T A 17: 38,082,240 H246L probably damaging Het
Olfr668 T C 7: 104,925,279 T162A probably benign Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,535,750 V2070A probably benign Het
Plcxd2 G T 16: 45,980,343 H173N probably damaging Het
Plec C G 15: 76,199,583 W26C probably benign Het
Psmc1 C T 12: 100,115,472 T111I probably benign Het
Rbfa T C 18: 80,192,766 E256G probably benign Het
Sh3d21 T A 4: 126,152,257 T173S probably benign Het
Slc41a3 T A 6: 90,626,444 V149E probably damaging Het
Sntg1 A G 1: 8,595,533 S186P probably damaging Het
Spag4 A G 2: 156,066,191 D29G probably benign Het
Spc25 A G 2: 69,202,652 V43A possibly damaging Het
Spen G A 4: 141,472,406 A2947V possibly damaging Het
Spta1 T C 1: 174,195,985 S653P probably damaging Het
Ssrp1 T A 2: 85,042,252 Y411* probably null Het
Synrg C T 11: 83,981,499 L149F probably damaging Het
Trappc11 G A 8: 47,493,342 A1085V possibly damaging Het
Ttn T C 2: 76,740,932 E18212G probably damaging Het
Wnk4 T G 11: 101,275,197 probably benign Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
R7410:Grip1 UTSW 10 120020020 missense probably benign 0.01
R7447:Grip1 UTSW 10 120086966 missense probably benign 0.01
R7539:Grip1 UTSW 10 120054871 missense probably benign 0.17
R7586:Grip1 UTSW 10 120077138 splice site probably null
R7768:Grip1 UTSW 10 120038397 missense probably damaging 0.98
R7831:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7896:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
R8103:Grip1 UTSW 10 119978535 missense probably benign 0.00
R8254:Grip1 UTSW 10 120054905 nonsense probably null
R8688:Grip1 UTSW 10 119999904 missense probably benign 0.12
RF011:Grip1 UTSW 10 119931315 missense probably null 0.97
Z1176:Grip1 UTSW 10 119819483 unclassified probably benign
Z1177:Grip1 UTSW 10 119986444 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAGAATGGTGTCCCTCATTCTC -3'
(R):5'- CCGTGCTCTATGAATAACACGG -3'

Sequencing Primer
(F):5'- GGTGTCCCTCATTCTCAAGAAAGAG -3'
(R):5'- CGTGCTCTATGAATAACACGGGTAAC -3'
Posted On2016-07-22