Incidental Mutation 'R5293:Wnk4'
ID405260
Institutional Source Beutler Lab
Gene Symbol Wnk4
Ensembl Gene ENSMUSG00000035112
Gene NameWNK lysine deficient protein kinase 4
Synonyms2010002J11Rik, Prkwnk4
MMRRC Submission 042876-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R5293 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101260567-101277409 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 101275197 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000017332] [ENSMUST00000103107] [ENSMUST00000103108] [ENSMUST00000139487] [ENSMUST00000147741] [ENSMUST00000168089] [ENSMUST00000170056]
Predicted Effect probably benign
Transcript: ENSMUST00000017332
SMART Domains Protein: ENSMUSP00000017332
Gene: ENSMUSG00000017188

DomainStartEndE-ValueType
Pfam:Coiled-coil_56 1 106 1.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103107
SMART Domains Protein: ENSMUSP00000099396
Gene: ENSMUSG00000078653

DomainStartEndE-ValueType
Pfam:Cyclin_N 111 180 1.8e-6 PFAM
low complexity region 212 221 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000103108
AA Change: L850R
SMART Domains Protein: ENSMUSP00000099397
Gene: ENSMUSG00000035112
AA Change: L850R

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 427 4.7e-42 PFAM
Pfam:Pkinase 171 429 9e-55 PFAM
Pfam:OSR1_C 450 486 3e-18 PFAM
low complexity region 503 513 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
low complexity region 627 638 N/A INTRINSIC
low complexity region 660 678 N/A INTRINSIC
low complexity region 757 778 N/A INTRINSIC
low complexity region 793 808 N/A INTRINSIC
low complexity region 841 877 N/A INTRINSIC
low complexity region 882 915 N/A INTRINSIC
low complexity region 921 951 N/A INTRINSIC
low complexity region 1014 1033 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128735
Predicted Effect probably benign
Transcript: ENSMUST00000139487
SMART Domains Protein: ENSMUSP00000129666
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase_Tyr 171 242 4e-8 PFAM
Pfam:Pkinase 171 252 1.9e-10 PFAM
low complexity region 269 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147741
SMART Domains Protein: ENSMUSP00000131298
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 126 155 N/A INTRINSIC
Pfam:Pkinase 171 394 9.3e-50 PFAM
Pfam:Pkinase_Tyr 171 399 3.7e-38 PFAM
low complexity region 401 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168089
SMART Domains Protein: ENSMUSP00000130367
Gene: ENSMUSG00000017188

DomainStartEndE-ValueType
Pfam:Coiled-coil_56 1 74 2.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170056
SMART Domains Protein: ENSMUSP00000132123
Gene: ENSMUSG00000035112

DomainStartEndE-ValueType
Pfam:OSR1_C 13 49 8.6e-20 PFAM
low complexity region 66 76 N/A INTRINSIC
low complexity region 79 93 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170372
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNK family of serine-threonine protein kinases. The kinase is part of the tight junction complex in kidney cells, and regulates the balance between NaCl reabsorption and K(+) secretion. The kinase regulates the activities of several types of ion channels, cotransporters, and exchangers involved in electrolyte flux in epithelial cells. Mutations in this gene result in pseudohypoaldosteronism type IIB.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele display increased Na+, K+ and Cl- urinary excretion, alkalosis and decreased plasma Cl-, K+, Mg2+ and renin levels. Mice homozygous for a point mutation exhibit acidosis, hypertension, increased circulating potassium levels and decreased potassium excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 A G 8: 24,810,706 V269A possibly damaging Het
Akap9 C T 5: 3,948,687 R19W probably damaging Het
Akr7a5 G T 4: 139,314,206 R142L probably benign Het
Atp6v0a2 A T 5: 124,646,709 M311L probably benign Het
Atxn1 C T 13: 45,568,368 R17H probably damaging Het
Ccdc116 A T 16: 17,141,787 L346Q possibly damaging Het
Copg2 T A 6: 30,826,227 N261I probably damaging Het
Crtc2 A G 3: 90,263,564 E648G probably benign Het
Dnah10 A C 5: 124,791,787 K2334Q probably benign Het
Foxa2 T C 2: 148,044,002 T123A probably benign Het
Galnt6 A G 15: 100,703,501 V299A probably benign Het
Grip1 T C 10: 119,897,735 S26P probably damaging Het
Jkamp A G 12: 72,090,109 S84G probably benign Het
Kcnc1 A G 7: 46,397,811 H45R probably benign Het
Knl1 T C 2: 119,069,695 Y626H probably damaging Het
Mmp19 T A 10: 128,791,101 V16D probably damaging Het
Mrpl38 T C 11: 116,132,773 N280S probably benign Het
Myl7 T A 11: 5,898,521 probably benign Het
Ngef CCCTCCTCCTCCTCCTCCTCCTCCTC CCCTCCTCCTCCTCCTCCTCCTC 1: 87,503,429 probably benign Het
Nlrp2 A C 7: 5,327,615 L594R probably damaging Het
Olfr1309 T G 2: 111,983,266 K269N probably damaging Het
Olfr131 T A 17: 38,082,240 H246L probably damaging Het
Olfr668 T C 7: 104,925,279 T162A probably benign Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Pkhd1l1 T C 15: 44,535,750 V2070A probably benign Het
Plcxd2 G T 16: 45,980,343 H173N probably damaging Het
Plec C G 15: 76,199,583 W26C probably benign Het
Psmc1 C T 12: 100,115,472 T111I probably benign Het
Rbfa T C 18: 80,192,766 E256G probably benign Het
Sh3d21 T A 4: 126,152,257 T173S probably benign Het
Slc41a3 T A 6: 90,626,444 V149E probably damaging Het
Sntg1 A G 1: 8,595,533 S186P probably damaging Het
Spag4 A G 2: 156,066,191 D29G probably benign Het
Spc25 A G 2: 69,202,652 V43A possibly damaging Het
Spen G A 4: 141,472,406 A2947V possibly damaging Het
Spta1 T C 1: 174,195,985 S653P probably damaging Het
Ssrp1 T A 2: 85,042,252 Y411* probably null Het
Synrg C T 11: 83,981,499 L149F probably damaging Het
Trappc11 G A 8: 47,493,342 A1085V possibly damaging Het
Ttn T C 2: 76,740,932 E18212G probably damaging Het
Other mutations in Wnk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wnk4 APN 11 101268748 missense possibly damaging 0.47
IGL00535:Wnk4 APN 11 101264349 missense probably damaging 1.00
IGL01401:Wnk4 APN 11 101276683 splice site probably benign
IGL01931:Wnk4 APN 11 101268484 missense possibly damaging 0.94
IGL01977:Wnk4 APN 11 101265414 missense probably damaging 1.00
IGL02165:Wnk4 APN 11 101275291 unclassified probably benign
IGL02197:Wnk4 APN 11 101263957 missense probably damaging 1.00
IGL02457:Wnk4 APN 11 101269563 splice site probably benign
IGL02963:Wnk4 APN 11 101276213 unclassified probably benign
ashamed UTSW 11 101265431 missense probably damaging 1.00
Caught_dead UTSW 11 101264330 missense probably damaging 1.00
mortification UTSW 11 101263894 makesense probably null
shame UTSW 11 101262856 missense probably damaging 1.00
R0066:Wnk4 UTSW 11 101265435 missense probably damaging 1.00
R0317:Wnk4 UTSW 11 101268804 missense probably benign 0.01
R0628:Wnk4 UTSW 11 101275023 missense probably benign 0.10
R0630:Wnk4 UTSW 11 101265386 missense probably damaging 1.00
R0710:Wnk4 UTSW 11 101274106 missense probably benign 0.22
R1290:Wnk4 UTSW 11 101276340 unclassified probably benign
R1482:Wnk4 UTSW 11 101269636 missense probably damaging 0.99
R1775:Wnk4 UTSW 11 101276340 unclassified probably benign
R2005:Wnk4 UTSW 11 101263890 missense probably damaging 1.00
R2229:Wnk4 UTSW 11 101275641 unclassified probably benign
R2258:Wnk4 UTSW 11 101275035 missense probably damaging 0.98
R2323:Wnk4 UTSW 11 101268481 missense probably damaging 0.99
R3081:Wnk4 UTSW 11 101276891 splice site probably benign
R3763:Wnk4 UTSW 11 101269288 missense probably benign 0.00
R4196:Wnk4 UTSW 11 101269631 missense probably damaging 1.00
R4447:Wnk4 UTSW 11 101268451 missense possibly damaging 0.65
R4614:Wnk4 UTSW 11 101274111 missense probably benign 0.00
R4751:Wnk4 UTSW 11 101276362 unclassified probably benign
R4948:Wnk4 UTSW 11 101268281 missense probably damaging 1.00
R5067:Wnk4 UTSW 11 101262856 missense probably damaging 1.00
R5073:Wnk4 UTSW 11 101261188 missense probably damaging 1.00
R5107:Wnk4 UTSW 11 101275538 unclassified probably benign
R5181:Wnk4 UTSW 11 101265377 missense probably damaging 0.96
R5205:Wnk4 UTSW 11 101265138 missense possibly damaging 0.89
R5252:Wnk4 UTSW 11 101268748 missense possibly damaging 0.47
R5273:Wnk4 UTSW 11 101263869 missense probably damaging 1.00
R5609:Wnk4 UTSW 11 101275636 unclassified probably benign
R5915:Wnk4 UTSW 11 101263894 makesense probably null
R5931:Wnk4 UTSW 11 101261221 missense probably damaging 0.99
R6126:Wnk4 UTSW 11 101276348 unclassified probably benign
R6164:Wnk4 UTSW 11 101275068 missense possibly damaging 0.56
R6191:Wnk4 UTSW 11 101264330 missense probably damaging 1.00
R6267:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R6274:Wnk4 UTSW 11 101265431 missense probably damaging 1.00
R6296:Wnk4 UTSW 11 101273998 missense probably damaging 1.00
R7132:Wnk4 UTSW 11 101261200 missense probably benign 0.22
R7251:Wnk4 UTSW 11 101265153 missense possibly damaging 0.70
R7352:Wnk4 UTSW 11 101264418 missense probably damaging 1.00
R7404:Wnk4 UTSW 11 101268492 critical splice donor site probably null
R7624:Wnk4 UTSW 11 101264354 nonsense probably null
R7634:Wnk4 UTSW 11 101262895 missense probably damaging 1.00
R7780:Wnk4 UTSW 11 101269577 missense probably damaging 0.96
R8006:Wnk4 UTSW 11 101268356 missense probably benign 0.00
R8046:Wnk4 UTSW 11 101274092 missense probably benign 0.20
R8143:Wnk4 UTSW 11 101262799 missense probably damaging 1.00
R8458:Wnk4 UTSW 11 101275321 nonsense probably null
R8735:Wnk4 UTSW 11 101276266 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGGTCTCGAATTTCAACCC -3'
(R):5'- CAGTCATCACAGCCAGAGAG -3'

Sequencing Primer
(F):5'- TCTTCAGCAGAGCCCCAGAG -3'
(R):5'- GCACTAGCCAGAGAGAGGAG -3'
Posted On2016-07-22