Mutagenetix > Incidental Mutation

Incidental Mutation 'R5294:Ror1'

405279

Institutional Source

Beutler Lab

Gene Symbol

Ror1

Ensembl Gene

ENSMUSG00000035305

Gene Name

receptor tyrosine kinase-like orphan receptor 1

Synonyms

2810404D04Rik, Ntrkr1

MMRRC Submission

042877-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5294 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100095791-100444765 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100425938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 400 (N400I)

Ref Sequence

ENSEMBL: ENSMUSP00000048171 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039630]

AlphaFold

Q9Z139

Predicted Effect

probably benign
Transcript: ENSMUST00000039630
AA Change: N400I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000048171
Gene: ENSMUSG00000035305
AA Change: N400I

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
IGc2	70	138	8.37e-15	SMART
Pfam:Fz	170	290	4.9e-13	PFAM
KR	311	393	7.57e-47	SMART
transmembrane domain	404	426	N/A	INTRINSIC
TyrKc	473	746	2.46e-137	SMART
low complexity region	753	762	N/A	INTRINSIC
low complexity region	817	828	N/A	INTRINSIC
low complexity region	849	864	N/A	INTRINSIC

Meta Mutation Damage Score

0.1016

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: This gene encodes a receptor tyrosine kinase that has been implicated in nervous system development, specifically in the maintenance of neural progenitor cell fate, neurite extension and synapse formation. The encoded protein, likely a pseudokinase that lacks catalytic activity, may also regulate adipogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first day after birth from respiratory defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	T	C	9: 89,152,003		noncoding transcript	Het
Acaca	A	G	11: 84,391,519	E2154G	probably benign	Het
Acacb	T	C	5: 114,241,952	F2056L	probably damaging	Het
Aff1	A	G	5: 103,811,157		probably benign	Het
Amn1	T	A	6: 149,185,124		probably benign	Het
Arid1a	C	A	4: 133,691,055		probably benign	Het
Aste1	T	A	9: 105,402,705		probably null	Het
Asxl3	T	A	18: 22,516,439	V495D	possibly damaging	Het
Atp1a3	T	A	7: 24,988,048	H688L	probably damaging	Het
B3gnt8	T	C	7: 25,628,766	L207P	probably damaging	Het
Baz2b	T	C	2: 59,978,602	H101R	probably benign	Het
Bicc1	G	A	10: 70,947,900	T387M	possibly damaging	Het
Champ1	A	C	8: 13,878,981	K380Q	probably damaging	Het
Cnst	A	G	1: 179,610,440	E523G	probably benign	Het
Cops6	G	C	5: 138,161,116		probably benign	Het
Cp	G	C	3: 19,966,316	V158L	probably benign	Het
Cyfip1	T	A	7: 55,873,483	M52K	possibly damaging	Het
Dars	A	T	1: 128,364,302	F480I	probably benign	Het
Diaph1	C	A	18: 37,897,550	E284*	probably null	Het
Diaph1	T	C	18: 37,897,580	M274V	unknown	Het
Dock8	G	A	19: 25,061,153	V68M	probably benign	Het
Elavl4	A	G	4: 110,211,430	F247L	possibly damaging	Het
Emc10	C	T	7: 44,496,439		probably benign	Het
Fbxw16	T	C	9: 109,436,644	D369G	probably benign	Het
Fgr	A	T	4: 132,997,500	D304V	probably benign	Het
Filip1l	G	A	16: 57,570,036	S91N	possibly damaging	Het
Gm884	A	G	11: 103,616,231		probably benign	Het
Haus8	A	G	8: 71,255,710	S103P	unknown	Het
Hscb	A	G	5: 110,834,792	L143P	probably damaging	Het
Hsd11b2	A	T	8: 105,523,297	M347L	probably benign	Het
Jrk	C	A	15: 74,707,336	E33D	possibly damaging	Het
Kbtbd8	T	A	6: 95,121,832	Y123*	probably null	Het
Mis18bp1	A	C	12: 65,157,043	M59R	probably damaging	Het
Mrps27	T	C	13: 99,409,873	V260A	probably damaging	Het
Ncapg2	G	T	12: 116,427,794	V488L	possibly damaging	Het
Nepn	A	T	10: 52,400,800	N211Y	probably benign	Het
Ntrk3	A	T	7: 78,517,506		probably null	Het
Olfr248	A	T	1: 174,391,225	Y52F	probably benign	Het
Olfr692	C	T	7: 105,368,413	T20I	probably benign	Het
Olfr748	A	G	14: 50,710,443	T38A	possibly damaging	Het
Olfr748	A	G	14: 50,710,779	I150V	probably benign	Het
Otud4	A	T	8: 79,672,892	Q744L	possibly damaging	Het
P2ry14	A	T	3: 59,115,568	I166N	possibly damaging	Het
Pak2	T	A	16: 32,021,830	N478Y	probably damaging	Het
Papss2	A	G	19: 32,639,000	D202G	probably benign	Het
Pcdh7	C	A	5: 57,728,111		probably null	Het
Peg3	C	A	7: 6,717,849	S19I	possibly damaging	Het
Prim2	G	T	1: 33,668,893	T40K	probably benign	Het
Ranbp2	T	C	10: 58,478,668	F1737L	probably benign	Het
Rex2	A	C	4: 147,057,985	N310T	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf39	C	T	17: 36,947,200	A86V	probably damaging	Het
Slc38a8	C	T	8: 119,494,289	G177D	probably damaging	Het
Slc43a3	T	C	2: 84,956,310	V445A	probably benign	Het
Sptbn2	A	G	19: 4,718,908	N23S	possibly damaging	Het
Taf5l	A	G	8: 124,008,218	F74L	probably benign	Het
Trappc11	G	C	8: 47,530,731	A42G	possibly damaging	Het
Trim30d	T	C	7: 104,472,488	K350R	probably damaging	Het
Trnt1	T	C	6: 106,773,414	F93S	probably damaging	Het
Ube2c	T	C	2: 164,777,190	V161A	probably benign	Het
Usp24	A	G	4: 106,362,357	E555G	possibly damaging	Het
Vmn2r55	T	G	7: 12,651,864	S730R	probably damaging	Het
Vmn2r89	T	A	14: 51,455,113	N124K	probably benign	Het
Vmn2r98	T	A	17: 19,069,754	C517*	probably null	Het
Vps13a	A	T	19: 16,641,667	I2845N	probably damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Xpo5	T	C	17: 46,236,922	V896A	probably benign	Het
Zfp2	T	C	11: 50,901,241		probably benign	Het
Zgrf1	G	A	3: 127,600,980	M1328I	probably benign	Het
Zswim5	A	G	4: 116,979,577	D686G	possibly damaging	Het

Other mutations in Ror1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Ror1	APN	4	100333743	missense	probably damaging	1.00
IGL00939:Ror1	APN	4	100441226	missense	probably benign	0.01
IGL01408:Ror1	APN	4	100333787	missense	probably damaging	1.00
IGL01678:Ror1	APN	4	100425968	missense	possibly damaging	0.68
IGL01700:Ror1	APN	4	100409771	missense	probably damaging	1.00
IGL01985:Ror1	APN	4	100425964	missense	possibly damaging	0.94
IGL02002:Ror1	APN	4	100441184	missense	probably damaging	1.00
IGL02634:Ror1	APN	4	100426110	missense	probably benign	0.00
IGL02995:Ror1	APN	4	100334525	splice site	probably benign
IGL03033:Ror1	APN	4	100411895	missense	possibly damaging	0.67
IGL03207:Ror1	APN	4	100407945	splice site	probably null
F5770:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
R0256:Ror1	UTSW	4	100409745	missense	probably benign	0.20
R0417:Ror1	UTSW	4	100412000	missense	possibly damaging	0.94
R0525:Ror1	UTSW	4	100441520	missense	probably damaging	1.00
R1034:Ror1	UTSW	4	100333620	nonsense	probably null
R1278:Ror1	UTSW	4	100441878	missense	possibly damaging	0.69
R1368:Ror1	UTSW	4	100441137	missense	possibly damaging	0.94
R1437:Ror1	UTSW	4	100412109	missense	probably benign
R1441:Ror1	UTSW	4	100440983	missense	probably benign
R1544:Ror1	UTSW	4	100441986	missense	probably damaging	1.00
R1717:Ror1	UTSW	4	100302938	missense	probably benign
R1857:Ror1	UTSW	4	100441503	missense	probably damaging	1.00
R2018:Ror1	UTSW	4	100407841	nonsense	probably null
R2051:Ror1	UTSW	4	100407868	nonsense	probably null
R2127:Ror1	UTSW	4	100442093	missense	probably benign
R2132:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2133:Ror1	UTSW	4	100410025	missense	probably benign	0.35
R2176:Ror1	UTSW	4	100441874	missense	probably damaging	0.99
R2431:Ror1	UTSW	4	100441155	missense	probably damaging	1.00
R2896:Ror1	UTSW	4	100096280	missense	unknown
R3005:Ror1	UTSW	4	100441764	missense	probably damaging	0.99
R3780:Ror1	UTSW	4	100412117	missense	probably benign	0.34
R3850:Ror1	UTSW	4	100442160	missense	possibly damaging	0.90
R3861:Ror1	UTSW	4	100407923	missense	possibly damaging	0.46
R4599:Ror1	UTSW	4	100407910	missense	probably damaging	0.99
R4863:Ror1	UTSW	4	100409804	missense	probably damaging	0.99
R4871:Ror1	UTSW	4	100425998	missense	probably benign
R4990:Ror1	UTSW	4	100441964	missense	probably benign
R5023:Ror1	UTSW	4	100425932	missense	probably benign	0.01
R5028:Ror1	UTSW	4	100411936	missense	possibly damaging	0.67
R5079:Ror1	UTSW	4	100441422	missense	probably damaging	1.00
R5538:Ror1	UTSW	4	100441011	missense	probably benign
R6339:Ror1	UTSW	4	100411931	missense	possibly damaging	0.91
R6491:Ror1	UTSW	4	100409912	missense	possibly damaging	0.94
R6632:Ror1	UTSW	4	100442106	missense	probably benign
R6733:Ror1	UTSW	4	100426055	missense	probably benign
R7022:Ror1	UTSW	4	100407911	missense	probably damaging	1.00
R7054:Ror1	UTSW	4	100442239	missense	probably benign	0.00
R7121:Ror1	UTSW	4	100302945	missense	probably benign	0.00
R7350:Ror1	UTSW	4	100425943	missense	probably benign	0.00
R7492:Ror1	UTSW	4	100441059	missense	probably benign	0.22
R7502:Ror1	UTSW	4	100333630	missense	probably benign	0.03
R7531:Ror1	UTSW	4	100441191	missense	probably damaging	1.00
R7661:Ror1	UTSW	4	100441490	missense	probably damaging	1.00
R7822:Ror1	UTSW	4	100441367	missense	probably damaging	1.00
R7831:Ror1	UTSW	4	100441098	missense	probably benign	0.01
R8366:Ror1	UTSW	4	100409998	missense	possibly damaging	0.91
R8539:Ror1	UTSW	4	100441887	missense	possibly damaging	0.71
R8757:Ror1	UTSW	4	100440883	missense	probably benign	0.01
R8862:Ror1	UTSW	4	100334518	critical splice donor site	probably null
R8913:Ror1	UTSW	4	100407830	missense	possibly damaging	0.89
R9382:Ror1	UTSW	4	100334512	missense	probably benign	0.00
V7580:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
V7583:Ror1	UTSW	4	100440933	missense	probably damaging	0.99
X0020:Ror1	UTSW	4	100426090	missense	probably benign	0.02
Z1177:Ror1	UTSW	4	100302919	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTTCACAATGTCCAGCTGTG -3'
(R):5'- GCATTGAGCATGGACATCTCC -3'

Sequencing Primer
(F):5'- TGTCCAGCTGTGATTTTCAAAC -3'
(R):5'- CACATTCTGTCCTCTGACGGG -3'

Posted On

2016-07-22