Incidental Mutation 'R5294:Elavl4'
ID405281
Institutional Source Beutler Lab
Gene Symbol Elavl4
Ensembl Gene ENSMUSG00000028546
Gene NameELAV like RNA binding protein 4
SynonymsHud
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location110203722-110351909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110211430 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 247 (F247L)
Ref Sequence ENSEMBL: ENSMUSP00000102214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102722] [ENSMUST00000102723] [ENSMUST00000106597] [ENSMUST00000106598] [ENSMUST00000106600] [ENSMUST00000106601] [ENSMUST00000106603] [ENSMUST00000138972]
Predicted Effect probably benign
Transcript: ENSMUST00000102722
AA Change: F249L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099783
Gene: ENSMUSG00000028546
AA Change: F249L

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 289 362 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102723
AA Change: F244L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000099784
Gene: ENSMUSG00000028546
AA Change: F244L

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 298 371 2.37e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106597
AA Change: F249L

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102207
Gene: ENSMUSG00000028546
AA Change: F249L

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
RRM 52 125 7.57e-24 SMART
RRM 138 213 1.35e-20 SMART
low complexity region 219 233 N/A INTRINSIC
RRM 303 376 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106598
AA Change: F244L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000102208
Gene: ENSMUSG00000028546
AA Change: F244L

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106600
AA Change: F261L

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102210
Gene: ENSMUSG00000028546
AA Change: F261L

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
RRM 64 137 7.57e-24 SMART
RRM 150 225 1.35e-20 SMART
low complexity region 231 245 N/A INTRINSIC
RRM 301 374 2.37e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106601
AA Change: F244L

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102212
Gene: ENSMUSG00000028546
AA Change: F244L

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
RRM 47 120 7.57e-24 SMART
RRM 133 208 1.35e-20 SMART
low complexity region 214 228 N/A INTRINSIC
RRM 284 357 2.37e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106603
AA Change: F247L

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102214
Gene: ENSMUSG00000028546
AA Change: F247L

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
RRM 50 123 7.57e-24 SMART
RRM 136 211 1.35e-20 SMART
low complexity region 217 231 N/A INTRINSIC
RRM 274 347 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138972
SMART Domains Protein: ENSMUSP00000123014
Gene: ENSMUSG00000028546

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
RRM 45 118 7.57e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153200
Meta Mutation Damage Score 0.1290 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased neural progenitor self-renewal and impaired neuronal differentiation, partial penetrance of hind limb clasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Elavl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Elavl4 APN 4 110206612 missense probably benign 0.03
IGL01777:Elavl4 APN 4 110206661 critical splice acceptor site probably null
IGL02212:Elavl4 APN 4 110206412 missense probably damaging 1.00
IGL03053:Elavl4 APN 4 110251494 missense possibly damaging 0.89
R0386:Elavl4 UTSW 4 110206705 intron probably benign
R1141:Elavl4 UTSW 4 110251368 nonsense probably null
R1826:Elavl4 UTSW 4 110251292 missense probably damaging 1.00
R5155:Elavl4 UTSW 4 110292636 missense probably null 0.22
R5507:Elavl4 UTSW 4 110213206 missense probably benign 0.17
R5558:Elavl4 UTSW 4 110206603 missense probably benign 0.37
R5927:Elavl4 UTSW 4 110290243 unclassified probably benign
R5987:Elavl4 UTSW 4 110290644 missense probably benign 0.40
R6376:Elavl4 UTSW 4 110255454 start gained probably benign
R6504:Elavl4 UTSW 4 110255382 intron probably null
R6987:Elavl4 UTSW 4 110251405 missense possibly damaging 0.70
R7278:Elavl4 UTSW 4 110211425 critical splice donor site probably null
R7431:Elavl4 UTSW 4 110226633 missense probably damaging 1.00
R7717:Elavl4 UTSW 4 110206466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGGCTAGGAAGTGCATTTTG -3'
(R):5'- CGCTTTGATAAGAGGATTGAGGC -3'

Sequencing Primer
(F):5'- CTAGGAAGTGCATTTTGTCTGATTGC -3'
(R):5'- CTTTGATAAGAGGATTGAGGCAGAAG -3'
Posted On2016-07-22