Incidental Mutation 'R5294:Zswim5'
ID405282
Institutional Source Beutler Lab
Gene Symbol Zswim5
Ensembl Gene ENSMUSG00000033948
Gene Namezinc finger SWIM-type containing 5
Synonyms4933426E21Rik
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116877376-116989264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116979577 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 686 (D686G)
Ref Sequence ENSEMBL: ENSMUSP00000049474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044823]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044823
AA Change: D686G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049474
Gene: ENSMUSG00000033948
AA Change: D686G

DomainStartEndE-ValueType
low complexity region 35 56 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
low complexity region 692 708 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Meta Mutation Damage Score 0.1241 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Other mutations in Zswim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Zswim5 APN 4 116985736 missense possibly damaging 0.93
IGL01700:Zswim5 APN 4 116986461 unclassified probably benign
IGL01975:Zswim5 APN 4 116965692 missense probably benign 0.03
IGL02334:Zswim5 APN 4 116986644 missense probably damaging 1.00
IGL02505:Zswim5 APN 4 116962552 missense probably benign 0.43
IGL02712:Zswim5 APN 4 116985695 missense probably damaging 0.99
PIT4243001:Zswim5 UTSW 4 116984778 missense probably benign 0.10
R0324:Zswim5 UTSW 4 116986906 missense probably damaging 1.00
R0611:Zswim5 UTSW 4 116986677 unclassified probably null
R0730:Zswim5 UTSW 4 116985746 missense possibly damaging 0.75
R1663:Zswim5 UTSW 4 116986895 missense probably damaging 1.00
R1843:Zswim5 UTSW 4 116877699 missense unknown
R2070:Zswim5 UTSW 4 116979912 missense probably benign 0.14
R2176:Zswim5 UTSW 4 116973041 missense probably damaging 0.99
R3715:Zswim5 UTSW 4 116962558 missense probably benign 0.21
R4044:Zswim5 UTSW 4 116986702 missense probably damaging 1.00
R4063:Zswim5 UTSW 4 116877980 missense unknown
R4118:Zswim5 UTSW 4 116986819 missense possibly damaging 0.93
R4612:Zswim5 UTSW 4 116986704 missense probably damaging 1.00
R4782:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4799:Zswim5 UTSW 4 116972972 missense probably benign 0.00
R4983:Zswim5 UTSW 4 116985686 missense possibly damaging 0.60
R5836:Zswim5 UTSW 4 116984803 missense probably benign 0.27
R6025:Zswim5 UTSW 4 116950909 missense probably damaging 1.00
R6041:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6042:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6043:Zswim5 UTSW 4 116962621 missense probably benign 0.01
R6159:Zswim5 UTSW 4 116979679 missense probably damaging 1.00
R6198:Zswim5 UTSW 4 116878007 missense probably benign 0.13
R6415:Zswim5 UTSW 4 116980866 missense possibly damaging 0.89
R6442:Zswim5 UTSW 4 116951005 missense probably damaging 1.00
R6547:Zswim5 UTSW 4 116986903 missense probably damaging 1.00
R6616:Zswim5 UTSW 4 116986741 missense possibly damaging 0.93
R6745:Zswim5 UTSW 4 116975204 missense probably damaging 1.00
R7144:Zswim5 UTSW 4 116975976 critical splice donor site probably null
R7260:Zswim5 UTSW 4 116962646 missense probably damaging 1.00
R7300:Zswim5 UTSW 4 116975905 missense probably damaging 1.00
R7310:Zswim5 UTSW 4 116984688 missense probably benign 0.01
R7326:Zswim5 UTSW 4 116980834 missense possibly damaging 0.75
R7429:Zswim5 UTSW 4 116975857 missense possibly damaging 0.87
R7430:Zswim5 UTSW 4 116975857 missense possibly damaging 0.87
R7607:Zswim5 UTSW 4 116986742 missense possibly damaging 0.93
R7811:Zswim5 UTSW 4 116877476 missense unknown
R8221:Zswim5 UTSW 4 116878022 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGAACTTGATAACTTGTTCTCCTC -3'
(R):5'- CAGCAAGCGTGTATGCTAACC -3'

Sequencing Primer
(F):5'- CTCCTCAGATATGAATGAAAGCAG -3'
(R):5'- AACATTTCTGTGCTATGTCAGAGAGG -3'
Posted On2016-07-22