Incidental Mutation 'R5294:Fgr'
ID405283
Institutional Source Beutler Lab
Gene Symbol Fgr
Ensembl Gene ENSMUSG00000028874
Gene NameFGR proto-oncogene, Src family tyrosine kinase
Synonyms
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132974095-133001910 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132997500 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 304 (D304V)
Ref Sequence ENSEMBL: ENSMUSP00000128411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030693] [ENSMUST00000171223]
Predicted Effect probably benign
Transcript: ENSMUST00000030693
AA Change: D304V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030693
Gene: ENSMUSG00000028874
AA Change: D304V

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138179
Predicted Effect probably benign
Transcript: ENSMUST00000171223
AA Change: D304V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128411
Gene: ENSMUSG00000028874
AA Change: D304V

DomainStartEndE-ValueType
SH3 68 125 5.39e-22 SMART
SH2 130 220 5.25e-36 SMART
TyrKc 251 500 5.5e-126 SMART
Meta Mutation Damage Score 0.2245 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to plasma membrane ruffles, and functions as a negative regulator of cell migration and adhesion triggered by the beta-2 integrin signal transduction pathway. Infection with Epstein-Barr virus results in the overexpression of this gene. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial reduction in hemorrhage following induction of a local Shwartzman reaction, and show enhanced NK-cell receptor-induced IFN-gamma production in natural killer (NK) cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Fgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02201:Fgr APN 4 132994924 missense probably damaging 0.99
IGL03089:Fgr APN 4 132986266 missense probably damaging 0.96
R1760:Fgr UTSW 4 132998342 missense possibly damaging 0.72
R1957:Fgr UTSW 4 132998362 missense probably benign
R2011:Fgr UTSW 4 132997521 missense probably damaging 1.00
R2109:Fgr UTSW 4 132998475 missense probably benign 0.32
R2351:Fgr UTSW 4 132997237 missense probably damaging 0.99
R2941:Fgr UTSW 4 132998423 missense probably benign
R3034:Fgr UTSW 4 132998496 critical splice donor site probably null
R4590:Fgr UTSW 4 132995053 missense probably damaging 1.00
R4770:Fgr UTSW 4 132987291 missense probably damaging 0.99
R4847:Fgr UTSW 4 132994648 missense probably damaging 1.00
R5384:Fgr UTSW 4 132986353 critical splice donor site probably null
R5388:Fgr UTSW 4 132995031 missense probably damaging 1.00
R5650:Fgr UTSW 4 133000222 missense probably benign 0.13
R6947:Fgr UTSW 4 132995069 critical splice donor site probably null
R7651:Fgr UTSW 4 132995013 missense probably damaging 1.00
R7686:Fgr UTSW 4 132998013 missense probably benign
R8011:Fgr UTSW 4 132998479 missense probably damaging 1.00
R8238:Fgr UTSW 4 132997521 missense probably damaging 1.00
Z1176:Fgr UTSW 4 133000170 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCATAGCACTGGAACGCAG -3'
(R):5'- GCACCTTCTGTCAAGAGGAG -3'

Sequencing Primer
(F):5'- CACCGGCTGCTTTGGAGATG -3'
(R):5'- TTCTGTCAAGAGGAGGCCCC -3'
Posted On2016-07-22