Incidental Mutation 'R5294:Hscb'
ID 405288
Institutional Source Beutler Lab
Gene Symbol Hscb
Ensembl Gene ENSMUSG00000043510
Gene Name HscB iron-sulfur cluster co-chaperone
Synonyms
MMRRC Submission 042877-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R5294 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 110976936-110987643 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110982658 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 143 (L143P)
Ref Sequence ENSEMBL: ENSMUSP00000062811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056937] [ENSMUST00000145318]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000056937
AA Change: L143P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062811
Gene: ENSMUSG00000043510
AA Change: L143P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DnaJ 70 135 6.53e-3 SMART
Pfam:HSCB_C 156 228 9.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122921
Predicted Effect probably benign
Transcript: ENSMUST00000144850
Predicted Effect probably benign
Transcript: ENSMUST00000145318
SMART Domains Protein: ENSMUSP00000120926
Gene: ENSMUSG00000043510

DomainStartEndE-ValueType
DnaJ 19 84 6.53e-3 SMART
Meta Mutation Damage Score 0.9668 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,034,056 (GRCm39) noncoding transcript Het
Acaca A G 11: 84,282,345 (GRCm39) E2154G probably benign Het
Acacb T C 5: 114,380,013 (GRCm39) F2056L probably damaging Het
Aff1 A G 5: 103,959,023 (GRCm39) probably benign Het
Amn1 T A 6: 149,086,622 (GRCm39) probably benign Het
Arid1a C A 4: 133,418,366 (GRCm39) probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Asxl3 T A 18: 22,649,496 (GRCm39) V495D possibly damaging Het
Atp1a3 T A 7: 24,687,473 (GRCm39) H688L probably damaging Het
B3gnt8 T C 7: 25,328,191 (GRCm39) L207P probably damaging Het
Baz2b T C 2: 59,808,946 (GRCm39) H101R probably benign Het
Bicc1 G A 10: 70,783,730 (GRCm39) T387M possibly damaging Het
Champ1 A C 8: 13,928,981 (GRCm39) K380Q probably damaging Het
Cnst A G 1: 179,438,005 (GRCm39) E523G probably benign Het
Cops6 G C 5: 138,159,378 (GRCm39) probably benign Het
Cp G C 3: 20,020,480 (GRCm39) V158L probably benign Het
Cyfip1 T A 7: 55,523,231 (GRCm39) M52K possibly damaging Het
Dars1 A T 1: 128,292,039 (GRCm39) F480I probably benign Het
Diaph1 C A 18: 38,030,603 (GRCm39) E284* probably null Het
Diaph1 T C 18: 38,030,633 (GRCm39) M274V unknown Het
Dock8 G A 19: 25,038,517 (GRCm39) V68M probably benign Het
Elavl4 A G 4: 110,068,627 (GRCm39) F247L possibly damaging Het
Emc10 C T 7: 44,145,863 (GRCm39) probably benign Het
Fbxw16 T C 9: 109,265,712 (GRCm39) D369G probably benign Het
Fgr A T 4: 132,724,811 (GRCm39) D304V probably benign Het
Filip1l G A 16: 57,390,399 (GRCm39) S91N possibly damaging Het
Haus8 A G 8: 71,708,354 (GRCm39) S103P unknown Het
Hsd11b2 A T 8: 106,249,929 (GRCm39) M347L probably benign Het
Jrk C A 15: 74,579,185 (GRCm39) E33D possibly damaging Het
Kbtbd8 T A 6: 95,098,813 (GRCm39) Y123* probably null Het
Lrrc37 A G 11: 103,507,057 (GRCm39) probably benign Het
Mis18bp1 A C 12: 65,203,817 (GRCm39) M59R probably damaging Het
Mrps27 T C 13: 99,546,381 (GRCm39) V260A probably damaging Het
Ncapg2 G T 12: 116,391,414 (GRCm39) V488L possibly damaging Het
Nepn A T 10: 52,276,896 (GRCm39) N211Y probably benign Het
Ntrk3 A T 7: 78,167,254 (GRCm39) probably null Het
Or10x4 A T 1: 174,218,791 (GRCm39) Y52F probably benign Het
Or11h23 A G 14: 50,948,236 (GRCm39) I150V probably benign Het
Or11h23 A G 14: 50,947,900 (GRCm39) T38A possibly damaging Het
Or52w1 C T 7: 105,017,620 (GRCm39) T20I probably benign Het
Otud4 A T 8: 80,399,521 (GRCm39) Q744L possibly damaging Het
P2ry14 A T 3: 59,022,989 (GRCm39) I166N possibly damaging Het
Pak2 T A 16: 31,840,648 (GRCm39) N478Y probably damaging Het
Papss2 A G 19: 32,616,400 (GRCm39) D202G probably benign Het
Pcdh7 C A 5: 57,885,453 (GRCm39) probably null Het
Peg3 C A 7: 6,720,848 (GRCm39) S19I possibly damaging Het
Prim2 G T 1: 33,707,974 (GRCm39) T40K probably benign Het
Ranbp2 T C 10: 58,314,490 (GRCm39) F1737L probably benign Het
Rex2 A C 4: 147,142,442 (GRCm39) N310T probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf39 C T 17: 37,258,092 (GRCm39) A86V probably damaging Het
Ror1 A T 4: 100,283,135 (GRCm39) N400I probably benign Het
Slc38a8 C T 8: 120,221,028 (GRCm39) G177D probably damaging Het
Slc43a3 T C 2: 84,786,654 (GRCm39) V445A probably benign Het
Sptbn2 A G 19: 4,768,936 (GRCm39) N23S possibly damaging Het
Taf5l A G 8: 124,734,957 (GRCm39) F74L probably benign Het
Trappc11 G C 8: 47,983,766 (GRCm39) A42G possibly damaging Het
Trim30d T C 7: 104,121,695 (GRCm39) K350R probably damaging Het
Trnt1 T C 6: 106,750,375 (GRCm39) F93S probably damaging Het
Ube2c T C 2: 164,619,110 (GRCm39) V161A probably benign Het
Usp24 A G 4: 106,219,554 (GRCm39) E555G possibly damaging Het
Vmn2r55 T G 7: 12,385,791 (GRCm39) S730R probably damaging Het
Vmn2r89 T A 14: 51,692,570 (GRCm39) N124K probably benign Het
Vmn2r98 T A 17: 19,290,016 (GRCm39) C517* probably null Het
Vps13a A T 19: 16,619,031 (GRCm39) I2845N probably damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Xpo5 T C 17: 46,547,848 (GRCm39) V896A probably benign Het
Zfp2 T C 11: 50,792,068 (GRCm39) probably benign Het
Zgrf1 G A 3: 127,394,629 (GRCm39) M1328I probably benign Het
Zswim5 A G 4: 116,836,774 (GRCm39) D686G possibly damaging Het
Other mutations in Hscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Hscb APN 5 110,978,820 (GRCm39) missense probably benign 0.00
IGL02170:Hscb APN 5 110,987,492 (GRCm39) missense probably damaging 1.00
potsticker UTSW 5 110,982,658 (GRCm39) missense probably damaging 1.00
PIT4520001:Hscb UTSW 5 110,983,851 (GRCm39) missense probably damaging 1.00
R0277:Hscb UTSW 5 110,982,556 (GRCm39) missense possibly damaging 0.91
R0323:Hscb UTSW 5 110,982,556 (GRCm39) missense possibly damaging 0.91
R1873:Hscb UTSW 5 110,978,823 (GRCm39) missense probably benign
R1940:Hscb UTSW 5 110,983,926 (GRCm39) missense probably benign
R3821:Hscb UTSW 5 110,984,194 (GRCm39) missense probably damaging 1.00
R5883:Hscb UTSW 5 110,987,444 (GRCm39) missense probably benign
R6337:Hscb UTSW 5 110,987,360 (GRCm39) critical splice donor site probably null
R7430:Hscb UTSW 5 110,977,024 (GRCm39) missense probably benign 0.04
R7625:Hscb UTSW 5 110,977,012 (GRCm39) missense probably damaging 1.00
R8052:Hscb UTSW 5 110,983,844 (GRCm39) missense probably benign 0.04
R9574:Hscb UTSW 5 110,982,595 (GRCm39) missense probably damaging 1.00
R9683:Hscb UTSW 5 110,983,881 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGTCCTCCTTGGGGAAATTAAGC -3'
(R):5'- ATACCAGCACTCACTGTTACTAGG -3'

Sequencing Primer
(F):5'- CGTCTGCGAGTCTTTCAT -3'
(R):5'- TCACTGTTACTAGGACAGCTCAAG -3'
Posted On 2016-07-22