Incidental Mutation 'R0497:C2cd5'
ID40529
Institutional Source Beutler Lab
Gene Symbol C2cd5
Ensembl Gene ENSMUSG00000030279
Gene NameC2 calcium-dependent domain containing 5
Synonyms5730419I09Rik, C030008B15Rik, CDP138
MMRRC Submission 038693-MU
Accession Numbers

Genbank: NM_001109688; NM_029081; NM_029897

Is this an essential gene? Possibly non essential (E-score: 0.427) question?
Stock #R0497 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location143010920-143100141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143012093 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 972 (V972A)
Ref Sequence ENSEMBL: ENSMUSP00000145019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087485] [ENSMUST00000111758] [ENSMUST00000171349] [ENSMUST00000203187] [ENSMUST00000203673] [ENSMUST00000204655] [ENSMUST00000205119]
Predicted Effect probably benign
Transcript: ENSMUST00000087485
AA Change: V963A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000084758
Gene: ENSMUSG00000030279
AA Change: V963A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 350 359 N/A INTRINSIC
internal_repeat_1 381 453 3.98e-5 PROSPERO
low complexity region 637 653 N/A INTRINSIC
internal_repeat_1 909 984 3.98e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000111758
AA Change: V963A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107388
Gene: ENSMUSG00000030279
AA Change: V963A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000171349
AA Change: V972A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127834
Gene: ENSMUSG00000030279
AA Change: V972A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000203187
AA Change: V989A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145373
Gene: ENSMUSG00000030279
AA Change: V989A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000203673
AA Change: V1025A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145425
Gene: ENSMUSG00000030279
AA Change: V1025A

DomainStartEndE-ValueType
C2 4 105 7.3e-18 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 361 370 N/A INTRINSIC
internal_repeat_1 392 464 4.65e-5 PROSPERO
low complexity region 648 664 N/A INTRINSIC
internal_repeat_1 971 1046 4.65e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204635
Predicted Effect probably benign
Transcript: ENSMUST00000204655
AA Change: V972A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145019
Gene: ENSMUSG00000030279
AA Change: V972A

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000205119
SMART Domains Protein: ENSMUSP00000145397
Gene: ENSMUSG00000030279

DomainStartEndE-ValueType
Pfam:C2 3 70 5.4e-14 PFAM
Meta Mutation Damage Score 0.0879 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in C2cd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:C2cd5 APN 6 143017945 missense probably null 0.99
IGL01065:C2cd5 APN 6 143078279 missense probably damaging 0.98
IGL01595:C2cd5 APN 6 143018022 missense probably damaging 1.00
IGL01654:C2cd5 APN 6 143081407 missense probably benign 0.06
IGL01917:C2cd5 APN 6 143072596 missense probably benign
IGL01966:C2cd5 APN 6 143012041 nonsense probably null
IGL02417:C2cd5 APN 6 143041492 missense probably damaging 1.00
IGL02616:C2cd5 APN 6 143035111 missense probably benign 0.10
IGL02745:C2cd5 APN 6 143041530 missense probably benign 0.17
IGL02819:C2cd5 APN 6 143083220 missense probably benign 0.33
IGL02926:C2cd5 APN 6 143031237 splice site probably benign
IGL02969:C2cd5 APN 6 143079943 missense probably damaging 1.00
IGL03072:C2cd5 APN 6 143079883 missense possibly damaging 0.89
IGL03226:C2cd5 APN 6 143072566 missense possibly damaging 0.86
D605:C2cd5 UTSW 6 143029660 missense probably benign 0.00
R0385:C2cd5 UTSW 6 143041490 missense probably damaging 1.00
R0644:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R0723:C2cd5 UTSW 6 143041555 splice site probably benign
R0740:C2cd5 UTSW 6 143036263 missense probably damaging 1.00
R1395:C2cd5 UTSW 6 143061738 splice site probably benign
R1475:C2cd5 UTSW 6 143072572 missense possibly damaging 0.47
R1494:C2cd5 UTSW 6 143041346 splice site probably benign
R1645:C2cd5 UTSW 6 143050126 missense probably damaging 1.00
R1928:C2cd5 UTSW 6 143013230 missense probably damaging 1.00
R2253:C2cd5 UTSW 6 143036316 nonsense probably null
R3934:C2cd5 UTSW 6 143041380 missense possibly damaging 0.96
R4065:C2cd5 UTSW 6 143073671 missense probably benign
R4654:C2cd5 UTSW 6 143030184 missense probably benign 0.00
R4691:C2cd5 UTSW 6 143030148 missense possibly damaging 0.47
R4972:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R5302:C2cd5 UTSW 6 143073756 missense probably benign 0.02
R5362:C2cd5 UTSW 6 143083243 missense probably damaging 1.00
R5604:C2cd5 UTSW 6 143012021 missense probably benign 0.44
R6139:C2cd5 UTSW 6 143035058 missense probably damaging 0.97
R6165:C2cd5 UTSW 6 143050228 missense possibly damaging 0.58
R6567:C2cd5 UTSW 6 143031248 missense possibly damaging 0.86
R6600:C2cd5 UTSW 6 143079976 missense probably damaging 0.99
R6821:C2cd5 UTSW 6 143017986 missense probably damaging 1.00
R6838:C2cd5 UTSW 6 143029638 missense possibly damaging 0.68
R7153:C2cd5 UTSW 6 143019409 missense probably benign 0.04
R7689:C2cd5 UTSW 6 143050225 nonsense probably null
X0013:C2cd5 UTSW 6 143067082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAAATTCTCAACTCTCCCAGATGTGC -3'
(R):5'- GCTTTAGCAACATCCAGCTTTCACC -3'

Sequencing Primer
(F):5'- GCTATCCAGCCGCATCC -3'
(R):5'- CATAAGGCATGGCCTCTTATTG -3'
Posted On2013-05-23