Incidental Mutation 'R5294:Cops6'
ID405291
Institutional Source Beutler Lab
Gene Symbol Cops6
Ensembl Gene ENSMUSG00000019494
Gene NameCOP9 signalosome subunit 6
SynonymsSgn3, VIP/MOV34, COP9 complex S6
MMRRC Submission 042877-MU
Accession Numbers

Genbank: NM_012002; MGI: 1349439

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138161071-138164646 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to C at 138161116 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000505] [ENSMUST00000019638] [ENSMUST00000110951] [ENSMUST00000132639] [ENSMUST00000148879]
Predicted Effect probably benign
Transcript: ENSMUST00000000505
SMART Domains Protein: ENSMUSP00000000505
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 1e-41 BLAST
MCM 145 642 N/A SMART
AAA 373 526 2.9e-4 SMART
Blast:MCM 658 719 1e-32 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000019638
AA Change: A2P
SMART Domains Protein: ENSMUSP00000019638
Gene: ENSMUSG00000019494
AA Change: A2P

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
JAB_MPN 37 170 9.73e-35 SMART
Pfam:MitMem_reg 191 304 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083593
Predicted Effect probably benign
Transcript: ENSMUST00000110951
SMART Domains Protein: ENSMUSP00000106576
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
JAB_MPN 10 143 9.73e-35 SMART
Pfam:MitMem_reg 163 279 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127881
Predicted Effect probably benign
Transcript: ENSMUST00000132639
SMART Domains Protein: ENSMUSP00000121554
Gene: ENSMUSG00000019494

DomainStartEndE-ValueType
Pfam:MitMem_reg 17 112 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148879
SMART Domains Protein: ENSMUSP00000116131
Gene: ENSMUSG00000029730

DomainStartEndE-ValueType
Blast:MCM 48 132 6e-44 BLAST
MCM 145 389 1.77e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154867
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the eight subunits of COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. This protein belongs to translation initiation factor 3 (eIF3) superfamily. It is involved in the regulation of cell cycle and likely to be a cellular cofactor for HIV-1 accessory gene product Vpr. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele or a transgenic gene disruption exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit increased sensitivity to irradiation and decreased incidence of ionizing radiation-induced tumors. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Gene trapped(15)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Cops6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Cops6 APN 5 138163378 missense probably damaging 1.00
IGL00929:Cops6 APN 5 138161386 start codon destroyed probably null 0.02
IGL01122:Cops6 APN 5 138162373 missense probably benign 0.42
IGL02652:Cops6 APN 5 138161438 unclassified probably null
R0593:Cops6 UTSW 5 138163580 missense probably benign 0.18
R2271:Cops6 UTSW 5 138161141 missense probably benign 0.00
R5011:Cops6 UTSW 5 138162197 missense probably benign 0.00
R5394:Cops6 UTSW 5 138163500 splice site probably null
R6225:Cops6 UTSW 5 138161411 missense possibly damaging 0.91
R6526:Cops6 UTSW 5 138163900 unclassified probably null
R6943:Cops6 UTSW 5 138163528 missense probably benign 0.43
R7242:Cops6 UTSW 5 138163580 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GACCTGGAAACTAATAGCCCTC -3'
(R):5'- TTCCCCTAGACATGGAAGCAG -3'

Sequencing Primer
(F):5'- TGGAAACTAATAGCCCTCCTTGG -3'
(R):5'- CCTAGACATGGAAGCAGGGGAC -3'
Posted On2016-07-22