Incidental Mutation 'R5294:Trnt1'
ID405294
Institutional Source Beutler Lab
Gene Symbol Trnt1
Ensembl Gene ENSMUSG00000013736
Gene NametRNA nucleotidyl transferase, CCA-adding, 1
SynonymsCGI-47, 2410043H24Rik, 2610044E04Rik
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location106769120-106782474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106773414 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 93 (F93S)
Ref Sequence ENSEMBL: ENSMUSP00000144850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057578] [ENSMUST00000113247] [ENSMUST00000113248] [ENSMUST00000113249] [ENSMUST00000204782] [ENSMUST00000205163]
Predicted Effect probably damaging
Transcript: ENSMUST00000057578
AA Change: F93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060900
Gene: ENSMUSG00000013736
AA Change: F93S

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113247
AA Change: F93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108873
Gene: ENSMUSG00000013736
AA Change: F93S

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 7.7e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113248
AA Change: F93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108874
Gene: ENSMUSG00000013736
AA Change: F93S

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 2.4e-37 PFAM
Pfam:PolyA_pol_RNAbd 215 272 9.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113249
AA Change: F93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108875
Gene: ENSMUSG00000013736
AA Change: F93S

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154026
Predicted Effect probably damaging
Transcript: ENSMUST00000204782
AA Change: F93S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144850
Gene: ENSMUSG00000013736
AA Change: F93S

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 134 3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205163
SMART Domains Protein: ENSMUSP00000144943
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
PDB:1OU5|B 30 72 2e-22 PDB
Meta Mutation Damage Score 0.9648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a CCA-adding enzyme which belongs to the tRNA nucleotidyltransferase/poly(A) polymerase family. This essential enzyme functions by catalyzing the addition of the conserved nucleotide triplet CCA to the 3' terminus of tRNA molecules. Mutations in this gene result in sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Trnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Trnt1 APN 6 106776222 nonsense probably null
IGL00915:Trnt1 APN 6 106779426 missense probably benign 0.00
IGL01821:Trnt1 APN 6 106774475 missense probably damaging 1.00
IGL02102:Trnt1 APN 6 106778112 critical splice donor site probably null
IGL02610:Trnt1 APN 6 106778818 missense possibly damaging 0.88
IGL02933:Trnt1 APN 6 106773426 missense probably benign 0.40
R0606:Trnt1 UTSW 6 106777908 unclassified probably benign
R0844:Trnt1 UTSW 6 106774503 missense probably damaging 1.00
R2144:Trnt1 UTSW 6 106778039 missense probably damaging 1.00
R2495:Trnt1 UTSW 6 106773369 missense possibly damaging 0.88
R4994:Trnt1 UTSW 6 106778892 nonsense probably null
R5742:Trnt1 UTSW 6 106778917 nonsense probably null
R6855:Trnt1 UTSW 6 106777922 missense probably damaging 1.00
R7491:Trnt1 UTSW 6 106778904 missense probably benign
R7492:Trnt1 UTSW 6 106774532 missense possibly damaging 0.76
R7880:Trnt1 UTSW 6 106769556 critical splice donor site probably null
R8212:Trnt1 UTSW 6 106769871 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATACAAGATTGCTCAGTTCACTG -3'
(R):5'- CGGCATGGACATTTCTATTGAGAC -3'

Sequencing Primer
(F):5'- CAGTTCACTGACCTCTACTATCTG -3'
(R):5'- TGAGACTTTTTAAAACACGGGAC -3'
Posted On2016-07-22