Incidental Mutation 'R5294:Vmn2r55'
ID 405298
Institutional Source Beutler Lab
Gene Symbol Vmn2r55
Ensembl Gene ENSMUSG00000091045
Gene Name vomeronasal 2, receptor 55
Synonyms
MMRRC Submission 042877-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R5294 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 12385633-12422855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12385791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 730 (S730R)
Ref Sequence ENSEMBL: ENSMUSP00000133483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172743]
AlphaFold A0A3B2W3J6
Predicted Effect probably damaging
Transcript: ENSMUST00000172743
AA Change: S730R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133483
Gene: ENSMUSG00000091045
AA Change: S730R

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.4e-57 PFAM
Pfam:7tm_3 525 762 3.7e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,034,056 (GRCm39) noncoding transcript Het
Acaca A G 11: 84,282,345 (GRCm39) E2154G probably benign Het
Acacb T C 5: 114,380,013 (GRCm39) F2056L probably damaging Het
Aff1 A G 5: 103,959,023 (GRCm39) probably benign Het
Amn1 T A 6: 149,086,622 (GRCm39) probably benign Het
Arid1a C A 4: 133,418,366 (GRCm39) probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Asxl3 T A 18: 22,649,496 (GRCm39) V495D possibly damaging Het
Atp1a3 T A 7: 24,687,473 (GRCm39) H688L probably damaging Het
B3gnt8 T C 7: 25,328,191 (GRCm39) L207P probably damaging Het
Baz2b T C 2: 59,808,946 (GRCm39) H101R probably benign Het
Bicc1 G A 10: 70,783,730 (GRCm39) T387M possibly damaging Het
Champ1 A C 8: 13,928,981 (GRCm39) K380Q probably damaging Het
Cnst A G 1: 179,438,005 (GRCm39) E523G probably benign Het
Cops6 G C 5: 138,159,378 (GRCm39) probably benign Het
Cp G C 3: 20,020,480 (GRCm39) V158L probably benign Het
Cyfip1 T A 7: 55,523,231 (GRCm39) M52K possibly damaging Het
Dars1 A T 1: 128,292,039 (GRCm39) F480I probably benign Het
Diaph1 C A 18: 38,030,603 (GRCm39) E284* probably null Het
Diaph1 T C 18: 38,030,633 (GRCm39) M274V unknown Het
Dock8 G A 19: 25,038,517 (GRCm39) V68M probably benign Het
Elavl4 A G 4: 110,068,627 (GRCm39) F247L possibly damaging Het
Emc10 C T 7: 44,145,863 (GRCm39) probably benign Het
Fbxw16 T C 9: 109,265,712 (GRCm39) D369G probably benign Het
Fgr A T 4: 132,724,811 (GRCm39) D304V probably benign Het
Filip1l G A 16: 57,390,399 (GRCm39) S91N possibly damaging Het
Haus8 A G 8: 71,708,354 (GRCm39) S103P unknown Het
Hscb A G 5: 110,982,658 (GRCm39) L143P probably damaging Het
Hsd11b2 A T 8: 106,249,929 (GRCm39) M347L probably benign Het
Jrk C A 15: 74,579,185 (GRCm39) E33D possibly damaging Het
Kbtbd8 T A 6: 95,098,813 (GRCm39) Y123* probably null Het
Lrrc37 A G 11: 103,507,057 (GRCm39) probably benign Het
Mis18bp1 A C 12: 65,203,817 (GRCm39) M59R probably damaging Het
Mrps27 T C 13: 99,546,381 (GRCm39) V260A probably damaging Het
Ncapg2 G T 12: 116,391,414 (GRCm39) V488L possibly damaging Het
Nepn A T 10: 52,276,896 (GRCm39) N211Y probably benign Het
Ntrk3 A T 7: 78,167,254 (GRCm39) probably null Het
Or10x4 A T 1: 174,218,791 (GRCm39) Y52F probably benign Het
Or11h23 A G 14: 50,947,900 (GRCm39) T38A possibly damaging Het
Or11h23 A G 14: 50,948,236 (GRCm39) I150V probably benign Het
Or52w1 C T 7: 105,017,620 (GRCm39) T20I probably benign Het
Otud4 A T 8: 80,399,521 (GRCm39) Q744L possibly damaging Het
P2ry14 A T 3: 59,022,989 (GRCm39) I166N possibly damaging Het
Pak2 T A 16: 31,840,648 (GRCm39) N478Y probably damaging Het
Papss2 A G 19: 32,616,400 (GRCm39) D202G probably benign Het
Pcdh7 C A 5: 57,885,453 (GRCm39) probably null Het
Peg3 C A 7: 6,720,848 (GRCm39) S19I possibly damaging Het
Prim2 G T 1: 33,707,974 (GRCm39) T40K probably benign Het
Ranbp2 T C 10: 58,314,490 (GRCm39) F1737L probably benign Het
Rex2 A C 4: 147,142,442 (GRCm39) N310T probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf39 C T 17: 37,258,092 (GRCm39) A86V probably damaging Het
Ror1 A T 4: 100,283,135 (GRCm39) N400I probably benign Het
Slc38a8 C T 8: 120,221,028 (GRCm39) G177D probably damaging Het
Slc43a3 T C 2: 84,786,654 (GRCm39) V445A probably benign Het
Sptbn2 A G 19: 4,768,936 (GRCm39) N23S possibly damaging Het
Taf5l A G 8: 124,734,957 (GRCm39) F74L probably benign Het
Trappc11 G C 8: 47,983,766 (GRCm39) A42G possibly damaging Het
Trim30d T C 7: 104,121,695 (GRCm39) K350R probably damaging Het
Trnt1 T C 6: 106,750,375 (GRCm39) F93S probably damaging Het
Ube2c T C 2: 164,619,110 (GRCm39) V161A probably benign Het
Usp24 A G 4: 106,219,554 (GRCm39) E555G possibly damaging Het
Vmn2r89 T A 14: 51,692,570 (GRCm39) N124K probably benign Het
Vmn2r98 T A 17: 19,290,016 (GRCm39) C517* probably null Het
Vps13a A T 19: 16,619,031 (GRCm39) I2845N probably damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Xpo5 T C 17: 46,547,848 (GRCm39) V896A probably benign Het
Zfp2 T C 11: 50,792,068 (GRCm39) probably benign Het
Zgrf1 G A 3: 127,394,629 (GRCm39) M1328I probably benign Het
Zswim5 A G 4: 116,836,774 (GRCm39) D686G possibly damaging Het
Other mutations in Vmn2r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Vmn2r55 APN 7 12,404,887 (GRCm39) missense probably damaging 1.00
IGL03035:Vmn2r55 APN 7 12,404,743 (GRCm39) missense probably benign 0.01
IGL03115:Vmn2r55 APN 7 12,404,558 (GRCm39) missense probably damaging 1.00
IGL03251:Vmn2r55 APN 7 12,405,120 (GRCm39) splice site probably benign
R0140:Vmn2r55 UTSW 7 12,402,104 (GRCm39) missense possibly damaging 0.58
R0511:Vmn2r55 UTSW 7 12,404,945 (GRCm39) missense possibly damaging 0.88
R1281:Vmn2r55 UTSW 7 12,404,825 (GRCm39) missense probably benign 0.02
R1564:Vmn2r55 UTSW 7 12,418,678 (GRCm39) missense probably damaging 1.00
R1602:Vmn2r55 UTSW 7 12,386,571 (GRCm39) missense probably damaging 1.00
R1785:Vmn2r55 UTSW 7 12,402,111 (GRCm39) missense probably damaging 0.98
R2939:Vmn2r55 UTSW 7 12,385,832 (GRCm39) missense probably damaging 1.00
R2993:Vmn2r55 UTSW 7 12,418,882 (GRCm39) missense probably damaging 1.00
R3151:Vmn2r55 UTSW 7 12,404,634 (GRCm39) missense probably benign 0.06
R4272:Vmn2r55 UTSW 7 12,402,106 (GRCm39) missense probably benign 0.38
R4589:Vmn2r55 UTSW 7 12,404,822 (GRCm39) missense probably damaging 0.99
R4624:Vmn2r55 UTSW 7 12,404,627 (GRCm39) missense possibly damaging 0.83
R4965:Vmn2r55 UTSW 7 12,404,478 (GRCm39) missense possibly damaging 0.91
R5364:Vmn2r55 UTSW 7 12,404,830 (GRCm39) missense possibly damaging 0.51
R5395:Vmn2r55 UTSW 7 12,385,874 (GRCm39) missense probably damaging 1.00
R5401:Vmn2r55 UTSW 7 12,385,871 (GRCm39) missense probably benign
R5701:Vmn2r55 UTSW 7 12,404,492 (GRCm39) missense probably benign 0.00
R5771:Vmn2r55 UTSW 7 12,404,959 (GRCm39) missense probably damaging 1.00
R5846:Vmn2r55 UTSW 7 12,404,492 (GRCm39) missense probably benign 0.05
R6148:Vmn2r55 UTSW 7 12,402,069 (GRCm39) missense probably benign 0.01
R6159:Vmn2r55 UTSW 7 12,385,698 (GRCm39) missense probably damaging 1.00
R6541:Vmn2r55 UTSW 7 12,404,939 (GRCm39) missense probably damaging 1.00
R7286:Vmn2r55 UTSW 7 12,386,000 (GRCm39) missense probably damaging 0.99
R7483:Vmn2r55 UTSW 7 12,404,755 (GRCm39) missense probably benign 0.00
R8269:Vmn2r55 UTSW 7 12,404,585 (GRCm39) missense possibly damaging 0.86
R8749:Vmn2r55 UTSW 7 12,385,796 (GRCm39) missense probably damaging 1.00
R8914:Vmn2r55 UTSW 7 12,405,024 (GRCm39) missense probably benign 0.09
R9049:Vmn2r55 UTSW 7 12,418,908 (GRCm39) missense probably damaging 1.00
R9175:Vmn2r55 UTSW 7 12,385,793 (GRCm39) missense possibly damaging 0.67
R9344:Vmn2r55 UTSW 7 12,385,782 (GRCm39) nonsense probably null
R9498:Vmn2r55 UTSW 7 12,404,812 (GRCm39) missense probably damaging 1.00
R9715:Vmn2r55 UTSW 7 12,402,061 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r55 UTSW 7 12,405,106 (GRCm39) missense possibly damaging 0.91
Z1177:Vmn2r55 UTSW 7 12,385,764 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCTTCTGTGGAGCATCTAACTC -3'
(R):5'- AGCCCCAGCACATTGTCATC -3'

Sequencing Primer
(F):5'- GTGGAGCATCTAACTCTGTCTATC -3'
(R):5'- TGTCATCCAATGCCATGATGG -3'
Posted On 2016-07-22