Incidental Mutation 'R5294:Atp1a3'
ID405299
Institutional Source Beutler Lab
Gene Symbol Atp1a3
Ensembl Gene ENSMUSG00000040907
Gene NameATPase, Na+/K+ transporting, alpha 3 polypeptide
SynonymsAtpa-2
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24978167-25005958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24988048 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 688 (H688L)
Ref Sequence ENSEMBL: ENSMUSP00000143735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684]
Predicted Effect probably damaging
Transcript: ENSMUST00000080882
AA Change: H675L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907
AA Change: H675L

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 125 356 6.3e-64 PFAM
Pfam:Hydrolase 360 719 2.6e-32 PFAM
Pfam:HAD 363 716 4.7e-18 PFAM
Pfam:Hydrolase_like2 416 511 5.7e-26 PFAM
Pfam:Cation_ATPase_C 789 998 3.5e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102858
AA Change: H675L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907
AA Change: H675L

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Cation_ATPase_N 32 106 2.41e-22 SMART
Pfam:E1-E2_ATPase 124 355 4.6e-60 PFAM
Pfam:Hydrolase 360 719 5.7e-20 PFAM
Pfam:HAD 363 716 4.5e-19 PFAM
Pfam:Cation_ATPase 416 511 5.1e-25 PFAM
Pfam:Cation_ATPase_C 789 998 1.4e-46 PFAM
low complexity region 1030 1047 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184595
Predicted Effect probably damaging
Transcript: ENSMUST00000196684
AA Change: H688L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907
AA Change: H688L

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Cation_ATPase_N 45 119 1.9e-26 SMART
Pfam:E1-E2_ATPase 137 368 4e-58 PFAM
Pfam:Hydrolase 373 732 3.8e-18 PFAM
Pfam:HAD 376 729 3.8e-17 PFAM
Pfam:Cation_ATPase 429 524 5.2e-23 PFAM
Pfam:Cation_ATPase_C 802 1011 2.5e-44 PFAM
Meta Mutation Damage Score 0.5759 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display neonatal lethality. Heterozygous mice display hyperactivity, increased activity in responses to methamphetamine, and impaired spatial learning. Mice heterozygous for an ENU mutation exhibit convulsive and vestibular stress induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Atp1a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Atp1a3 APN 7 24997286 missense probably damaging 0.98
IGL02736:Atp1a3 APN 7 24980109 missense probably damaging 1.00
IGL02738:Atp1a3 APN 7 24990476 missense possibly damaging 0.86
IGL02806:Atp1a3 APN 7 24981872 missense probably damaging 1.00
borah UTSW 7 24994569 missense probably damaging 1.00
Clonic UTSW 7 24987985 missense probably benign 0.37
Littlewolf UTSW 7 24981791 missense probably damaging 1.00
R0003:Atp1a3 UTSW 7 24989564 splice site probably benign
R0254:Atp1a3 UTSW 7 24981512 splice site probably benign
R0420:Atp1a3 UTSW 7 24980627 missense probably benign
R0437:Atp1a3 UTSW 7 24998967 missense probably benign 0.36
R0666:Atp1a3 UTSW 7 24990549 missense probably benign 0.01
R0932:Atp1a3 UTSW 7 24987976 critical splice donor site probably null
R1586:Atp1a3 UTSW 7 24979383 missense probably damaging 0.97
R1981:Atp1a3 UTSW 7 25000975 missense probably benign 0.19
R2105:Atp1a3 UTSW 7 24989853 missense probably damaging 1.00
R3076:Atp1a3 UTSW 7 24980073 missense possibly damaging 0.48
R3110:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R3112:Atp1a3 UTSW 7 24994694 missense probably damaging 1.00
R4223:Atp1a3 UTSW 7 25000930 missense probably benign 0.09
R4327:Atp1a3 UTSW 7 24987631 intron probably benign
R4598:Atp1a3 UTSW 7 24979341 missense probably damaging 0.99
R4626:Atp1a3 UTSW 7 24998768 missense possibly damaging 0.75
R4789:Atp1a3 UTSW 7 24998964 missense probably damaging 1.00
R4963:Atp1a3 UTSW 7 24994626 missense probably damaging 0.97
R5243:Atp1a3 UTSW 7 24994569 missense probably damaging 1.00
R5668:Atp1a3 UTSW 7 24978869 intron probably benign
R5704:Atp1a3 UTSW 7 24997311 missense probably damaging 0.98
R5870:Atp1a3 UTSW 7 24997578 missense probably benign 0.03
R5934:Atp1a3 UTSW 7 24978874 intron probably benign
R6183:Atp1a3 UTSW 7 24981752 missense probably damaging 1.00
R6492:Atp1a3 UTSW 7 24979304 missense probably damaging 1.00
R6996:Atp1a3 UTSW 7 24997626 missense probably damaging 1.00
R7165:Atp1a3 UTSW 7 24978965 missense probably benign 0.13
R7229:Atp1a3 UTSW 7 24987985 missense probably benign 0.37
R7239:Atp1a3 UTSW 7 25000704 missense probably damaging 1.00
R7301:Atp1a3 UTSW 7 24990515 missense probably benign 0.00
R7330:Atp1a3 UTSW 7 25001152 nonsense probably null
R7348:Atp1a3 UTSW 7 24978826 missense unknown
R7432:Atp1a3 UTSW 7 25005875 unclassified probably benign
R7490:Atp1a3 UTSW 7 24987470 missense probably damaging 1.00
R7556:Atp1a3 UTSW 7 24981566 missense probably benign 0.02
R7860:Atp1a3 UTSW 7 24981791 missense probably damaging 1.00
R7861:Atp1a3 UTSW 7 25001148 missense unknown
R7993:Atp1a3 UTSW 7 25000981 critical splice acceptor site probably null
R8002:Atp1a3 UTSW 7 25000671 missense probably damaging 1.00
R8010:Atp1a3 UTSW 7 24980645 missense possibly damaging 0.90
R8430:Atp1a3 UTSW 7 24999012 missense probably damaging 1.00
R8780:Atp1a3 UTSW 7 24981554 missense probably damaging 0.96
R8837:Atp1a3 UTSW 7 24978555 missense probably damaging 1.00
Z1176:Atp1a3 UTSW 7 24998688 missense probably benign 0.00
Z1177:Atp1a3 UTSW 7 24980119 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTGAGAACCAACTCTTCAG -3'
(R):5'- TAACCTTATCATGCCGGTCC -3'

Sequencing Primer
(F):5'- ACTAGGGATCTAGGTCCAAGCTTC -3'
(R):5'- ATGCCGGTCCCTCCTCTG -3'
Posted On2016-07-22