Incidental Mutation 'R5294:Ntrk3'
ID405303
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
SynonymsTrkC
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 78517506 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000193002] [ENSMUST00000195262] [ENSMUST00000195262] [ENSMUST00000206268] [ENSMUST00000206268]
Predicted Effect probably null
Transcript: ENSMUST00000039431
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably null
Transcript: ENSMUST00000039438
SMART Domains Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 3.1e-8 PFAM
transmembrane domain 429 451 N/A INTRINSIC
PDB:2MFQ|B 497 517 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155795
Predicted Effect probably null
Transcript: ENSMUST00000193002
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193002
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195262
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect probably null
Transcript: ENSMUST00000195262
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206167
Predicted Effect probably null
Transcript: ENSMUST00000206268
Predicted Effect probably null
Transcript: ENSMUST00000206268
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1929:Ntrk3 UTSW 7 78516723 splice site probably null
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3959:Ntrk3 UTSW 7 78198842 missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4028:Ntrk3 UTSW 7 78192710 missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5045:Ntrk3 UTSW 7 78460424 missense probably benign 0.13
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 78247300 missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78451928 missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
R7083:Ntrk3 UTSW 7 78250839 missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78356147 missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 78250713 missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 78250873 missense probably benign 0.03
R7800:Ntrk3 UTSW 7 78302740 missense probably benign 0.09
R8009:Ntrk3 UTSW 7 78453328 missense probably benign
R8032:Ntrk3 UTSW 7 78356059 missense probably damaging 1.00
R8104:Ntrk3 UTSW 7 78577702 missense probably damaging 0.99
R8230:Ntrk3 UTSW 7 78250770 missense probably damaging 1.00
R8254:Ntrk3 UTSW 7 78192578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAACAGCAGGCTTTCC -3'
(R):5'- TTCTCGAGCTGGGGATAGATGC -3'

Sequencing Primer
(F):5'- CCATTACTACTACTTCGGATGACAGG -3'
(R):5'- GGATAGATGCTAAGCACTCTGTCC -3'
Posted On2016-07-22