Incidental Mutation 'R5294:Champ1'
ID405306
Institutional Source Beutler Lab
Gene Symbol Champ1
Ensembl Gene ENSMUSG00000047710
Gene Namechromosome alignment maintaining phosphoprotein 1
SynonymsZfp828, D8Ertd457e, D8Ertd569e
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13869641-13881639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 13878981 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 380 (K380Q)
Ref Sequence ENSEMBL: ENSMUSP00000120117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051870] [ENSMUST00000128557]
Predicted Effect probably damaging
Transcript: ENSMUST00000051870
AA Change: K380Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057270
Gene: ENSMUSG00000047710
AA Change: K380Q

DomainStartEndE-ValueType
ZnF_C2H2 14 37 1.62e0 SMART
ZnF_C2H2 62 85 2.29e1 SMART
internal_repeat_1 109 278 1.19e-9 PROSPERO
low complexity region 298 318 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
internal_repeat_1 373 534 1.19e-9 PROSPERO
low complexity region 602 613 N/A INTRINSIC
low complexity region 677 690 N/A INTRINSIC
ZnF_C2H2 699 722 2.68e1 SMART
ZnF_C2H2 728 750 1.79e-2 SMART
ZnF_C2H2 755 776 2.23e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083883
Predicted Effect probably damaging
Transcript: ENSMUST00000128557
AA Change: K380Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120117
Gene: ENSMUSG00000047710
AA Change: K380Q

DomainStartEndE-ValueType
ZnF_C2H2 14 37 1.62e0 SMART
ZnF_C2H2 62 85 2.29e1 SMART
internal_repeat_1 109 278 5.23e-7 PROSPERO
low complexity region 298 318 N/A INTRINSIC
low complexity region 354 368 N/A INTRINSIC
internal_repeat_1 373 534 5.23e-7 PROSPERO
low complexity region 602 613 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197610
Meta Mutation Damage Score 0.1149 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that functions as a regulator of chromosome segregation in mitosis. The encoded protein is required for correct alignment of chromosomes on the metaphase plate, and plays a role in maintaining the attachment of sister kinetochores to microtubules from opposite spindle poles. Mutations in this gene are associated with autosomal dominant mental retardation-40. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Champ1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Champ1 APN 8 13879522 missense possibly damaging 0.68
IGL00775:Champ1 APN 8 13879509 missense probably damaging 1.00
IGL02451:Champ1 APN 8 13878739 missense probably damaging 1.00
IGL03283:Champ1 APN 8 13878786 missense probably benign 0.04
PIT4810001:Champ1 UTSW 8 13879234 missense probably benign 0.37
R0664:Champ1 UTSW 8 13879485 missense probably damaging 0.96
R2219:Champ1 UTSW 8 13880017 missense probably damaging 1.00
R3077:Champ1 UTSW 8 13878832 missense probably benign
R3735:Champ1 UTSW 8 13878735 missense probably damaging 1.00
R3838:Champ1 UTSW 8 13879939 missense probably damaging 1.00
R4714:Champ1 UTSW 8 13878063 missense probably damaging 1.00
R4933:Champ1 UTSW 8 13879137 missense probably benign 0.14
R5893:Champ1 UTSW 8 13878777 missense probably benign 0.08
R6548:Champ1 UTSW 8 13880002 missense probably damaging 1.00
R7261:Champ1 UTSW 8 13878517 missense possibly damaging 0.90
R7467:Champ1 UTSW 8 13878579 missense possibly damaging 0.89
R7747:Champ1 UTSW 8 13879990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTCCTTCAGCAACATC -3'
(R):5'- AAGTTTTCCGCTGGTCAGGAG -3'

Sequencing Primer
(F):5'- CATCAGGACCGTGGAAGTCATC -3'
(R):5'- TTTCCGCTGGTCAGGAGAAACC -3'
Posted On2016-07-22