Incidental Mutation 'R5294:Slc38a8'
ID 405310
Institutional Source Beutler Lab
Gene Symbol Slc38a8
Ensembl Gene ENSMUSG00000034224
Gene Name solute carrier family 38, member 8
Synonyms LOC234788
MMRRC Submission 042877-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5294 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 120206341-120228437 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 120221028 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 177 (G177D)
Ref Sequence ENSEMBL: ENSMUSP00000119987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036748] [ENSMUST00000133821] [ENSMUST00000138061]
AlphaFold Q5HZH7
Predicted Effect probably damaging
Transcript: ENSMUST00000036748
AA Change: G177D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224
AA Change: G177D

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132838
SMART Domains Protein: ENSMUSP00000121251
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 39 289 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133821
SMART Domains Protein: ENSMUSP00000123094
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 22 163 2.1e-10 PFAM
Pfam:Aa_trans 22 165 3.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138061
AA Change: G177D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224
AA Change: G177D

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Meta Mutation Damage Score 0.5278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative sodium-dependent amino-acid/proton antiporter. The protein has eleven transmembrane domains, an extracellular N-terminus and an intracellular C-terminal tail. The protein is a member of the SLC38 sodium-coupled neutral amino acid transporter family of proteins. Mutations in this gene result in foveal hypoplasia with or without optic nerve misrouting and/or anterior segment dysgenesis. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,034,056 (GRCm39) noncoding transcript Het
Acaca A G 11: 84,282,345 (GRCm39) E2154G probably benign Het
Acacb T C 5: 114,380,013 (GRCm39) F2056L probably damaging Het
Aff1 A G 5: 103,959,023 (GRCm39) probably benign Het
Amn1 T A 6: 149,086,622 (GRCm39) probably benign Het
Arid1a C A 4: 133,418,366 (GRCm39) probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Asxl3 T A 18: 22,649,496 (GRCm39) V495D possibly damaging Het
Atp1a3 T A 7: 24,687,473 (GRCm39) H688L probably damaging Het
B3gnt8 T C 7: 25,328,191 (GRCm39) L207P probably damaging Het
Baz2b T C 2: 59,808,946 (GRCm39) H101R probably benign Het
Bicc1 G A 10: 70,783,730 (GRCm39) T387M possibly damaging Het
Champ1 A C 8: 13,928,981 (GRCm39) K380Q probably damaging Het
Cnst A G 1: 179,438,005 (GRCm39) E523G probably benign Het
Cops6 G C 5: 138,159,378 (GRCm39) probably benign Het
Cp G C 3: 20,020,480 (GRCm39) V158L probably benign Het
Cyfip1 T A 7: 55,523,231 (GRCm39) M52K possibly damaging Het
Dars1 A T 1: 128,292,039 (GRCm39) F480I probably benign Het
Diaph1 C A 18: 38,030,603 (GRCm39) E284* probably null Het
Diaph1 T C 18: 38,030,633 (GRCm39) M274V unknown Het
Dock8 G A 19: 25,038,517 (GRCm39) V68M probably benign Het
Elavl4 A G 4: 110,068,627 (GRCm39) F247L possibly damaging Het
Emc10 C T 7: 44,145,863 (GRCm39) probably benign Het
Fbxw16 T C 9: 109,265,712 (GRCm39) D369G probably benign Het
Fgr A T 4: 132,724,811 (GRCm39) D304V probably benign Het
Filip1l G A 16: 57,390,399 (GRCm39) S91N possibly damaging Het
Haus8 A G 8: 71,708,354 (GRCm39) S103P unknown Het
Hscb A G 5: 110,982,658 (GRCm39) L143P probably damaging Het
Hsd11b2 A T 8: 106,249,929 (GRCm39) M347L probably benign Het
Jrk C A 15: 74,579,185 (GRCm39) E33D possibly damaging Het
Kbtbd8 T A 6: 95,098,813 (GRCm39) Y123* probably null Het
Lrrc37 A G 11: 103,507,057 (GRCm39) probably benign Het
Mis18bp1 A C 12: 65,203,817 (GRCm39) M59R probably damaging Het
Mrps27 T C 13: 99,546,381 (GRCm39) V260A probably damaging Het
Ncapg2 G T 12: 116,391,414 (GRCm39) V488L possibly damaging Het
Nepn A T 10: 52,276,896 (GRCm39) N211Y probably benign Het
Ntrk3 A T 7: 78,167,254 (GRCm39) probably null Het
Or10x4 A T 1: 174,218,791 (GRCm39) Y52F probably benign Het
Or11h23 A G 14: 50,947,900 (GRCm39) T38A possibly damaging Het
Or11h23 A G 14: 50,948,236 (GRCm39) I150V probably benign Het
Or52w1 C T 7: 105,017,620 (GRCm39) T20I probably benign Het
Otud4 A T 8: 80,399,521 (GRCm39) Q744L possibly damaging Het
P2ry14 A T 3: 59,022,989 (GRCm39) I166N possibly damaging Het
Pak2 T A 16: 31,840,648 (GRCm39) N478Y probably damaging Het
Papss2 A G 19: 32,616,400 (GRCm39) D202G probably benign Het
Pcdh7 C A 5: 57,885,453 (GRCm39) probably null Het
Peg3 C A 7: 6,720,848 (GRCm39) S19I possibly damaging Het
Prim2 G T 1: 33,707,974 (GRCm39) T40K probably benign Het
Ranbp2 T C 10: 58,314,490 (GRCm39) F1737L probably benign Het
Rex2 A C 4: 147,142,442 (GRCm39) N310T probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf39 C T 17: 37,258,092 (GRCm39) A86V probably damaging Het
Ror1 A T 4: 100,283,135 (GRCm39) N400I probably benign Het
Slc43a3 T C 2: 84,786,654 (GRCm39) V445A probably benign Het
Sptbn2 A G 19: 4,768,936 (GRCm39) N23S possibly damaging Het
Taf5l A G 8: 124,734,957 (GRCm39) F74L probably benign Het
Trappc11 G C 8: 47,983,766 (GRCm39) A42G possibly damaging Het
Trim30d T C 7: 104,121,695 (GRCm39) K350R probably damaging Het
Trnt1 T C 6: 106,750,375 (GRCm39) F93S probably damaging Het
Ube2c T C 2: 164,619,110 (GRCm39) V161A probably benign Het
Usp24 A G 4: 106,219,554 (GRCm39) E555G possibly damaging Het
Vmn2r55 T G 7: 12,385,791 (GRCm39) S730R probably damaging Het
Vmn2r89 T A 14: 51,692,570 (GRCm39) N124K probably benign Het
Vmn2r98 T A 17: 19,290,016 (GRCm39) C517* probably null Het
Vps13a A T 19: 16,619,031 (GRCm39) I2845N probably damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Xpo5 T C 17: 46,547,848 (GRCm39) V896A probably benign Het
Zfp2 T C 11: 50,792,068 (GRCm39) probably benign Het
Zgrf1 G A 3: 127,394,629 (GRCm39) M1328I probably benign Het
Zswim5 A G 4: 116,836,774 (GRCm39) D686G possibly damaging Het
Other mutations in Slc38a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc38a8 APN 8 120,220,958 (GRCm39) missense probably benign 0.01
IGL02167:Slc38a8 APN 8 120,214,099 (GRCm39) missense probably benign 0.03
IGL02565:Slc38a8 APN 8 120,212,300 (GRCm39) missense probably damaging 1.00
IGL02899:Slc38a8 APN 8 120,212,282 (GRCm39) missense probably benign 0.34
IGL03177:Slc38a8 APN 8 120,212,251 (GRCm39) missense probably damaging 1.00
IGL03282:Slc38a8 APN 8 120,226,455 (GRCm39) missense probably damaging 0.99
R1109:Slc38a8 UTSW 8 120,209,394 (GRCm39) missense probably benign
R1116:Slc38a8 UTSW 8 120,222,872 (GRCm39) missense probably damaging 1.00
R2247:Slc38a8 UTSW 8 120,212,389 (GRCm39) missense probably benign 0.00
R4964:Slc38a8 UTSW 8 120,209,423 (GRCm39) splice site probably null
R5303:Slc38a8 UTSW 8 120,212,780 (GRCm39) missense possibly damaging 0.66
R5430:Slc38a8 UTSW 8 120,220,959 (GRCm39) missense probably benign 0.16
R5643:Slc38a8 UTSW 8 120,207,488 (GRCm39) makesense probably null
R6016:Slc38a8 UTSW 8 120,221,044 (GRCm39) splice site probably null
R7346:Slc38a8 UTSW 8 120,226,554 (GRCm39) nonsense probably null
R7425:Slc38a8 UTSW 8 120,212,327 (GRCm39) missense possibly damaging 0.89
R7502:Slc38a8 UTSW 8 120,227,820 (GRCm39) missense possibly damaging 0.60
R8081:Slc38a8 UTSW 8 120,212,269 (GRCm39) missense possibly damaging 0.54
R9083:Slc38a8 UTSW 8 120,212,780 (GRCm39) missense probably benign 0.11
R9109:Slc38a8 UTSW 8 120,212,851 (GRCm39) missense possibly damaging 0.54
R9298:Slc38a8 UTSW 8 120,212,851 (GRCm39) missense possibly damaging 0.54
R9472:Slc38a8 UTSW 8 120,227,888 (GRCm39) missense probably damaging 0.99
R9595:Slc38a8 UTSW 8 120,209,403 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGCTTTGTCCTCAGCAAAC -3'
(R):5'- AAGAGATATCCCAGTTGCCCTC -3'

Sequencing Primer
(F):5'- TTTGTCCTCAGCAAACCCCAGAG -3'
(R):5'- AAGGATGCTGGGCCACTCTG -3'
Posted On 2016-07-22