Incidental Mutation 'R5294:Slc38a8'
ID405310
Institutional Source Beutler Lab
Gene Symbol Slc38a8
Ensembl Gene ENSMUSG00000034224
Gene Namesolute carrier family 38, member 8
SynonymsLOC234788
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119479602-119501698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119494289 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 177 (G177D)
Ref Sequence ENSEMBL: ENSMUSP00000119987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036748] [ENSMUST00000133821] [ENSMUST00000138061]
Predicted Effect probably damaging
Transcript: ENSMUST00000036748
AA Change: G177D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224
AA Change: G177D

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132838
SMART Domains Protein: ENSMUSP00000121251
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 39 289 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133821
SMART Domains Protein: ENSMUSP00000123094
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 22 163 2.1e-10 PFAM
Pfam:Aa_trans 22 165 3.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138061
AA Change: G177D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224
AA Change: G177D

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Meta Mutation Damage Score 0.5278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative sodium-dependent amino-acid/proton antiporter. The protein has eleven transmembrane domains, an extracellular N-terminus and an intracellular C-terminal tail. The protein is a member of the SLC38 sodium-coupled neutral amino acid transporter family of proteins. Mutations in this gene result in foveal hypoplasia with or without optic nerve misrouting and/or anterior segment dysgenesis. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Slc38a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc38a8 APN 8 119494219 missense probably benign 0.01
IGL02167:Slc38a8 APN 8 119487360 missense probably benign 0.03
IGL02565:Slc38a8 APN 8 119485561 missense probably damaging 1.00
IGL02899:Slc38a8 APN 8 119485543 missense probably benign 0.34
IGL03177:Slc38a8 APN 8 119485512 missense probably damaging 1.00
IGL03282:Slc38a8 APN 8 119499716 missense probably damaging 0.99
R1109:Slc38a8 UTSW 8 119482655 missense probably benign
R1116:Slc38a8 UTSW 8 119496133 missense probably damaging 1.00
R2247:Slc38a8 UTSW 8 119485650 missense probably benign 0.00
R4964:Slc38a8 UTSW 8 119482684 splice site probably null
R5303:Slc38a8 UTSW 8 119486041 missense possibly damaging 0.66
R5430:Slc38a8 UTSW 8 119494220 missense probably benign 0.16
R5643:Slc38a8 UTSW 8 119480749 makesense probably null
R6016:Slc38a8 UTSW 8 119494305 splice site probably null
R7346:Slc38a8 UTSW 8 119499815 nonsense probably null
R7425:Slc38a8 UTSW 8 119485588 missense possibly damaging 0.89
R7502:Slc38a8 UTSW 8 119501081 missense possibly damaging 0.60
R8081:Slc38a8 UTSW 8 119485530 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CTTGGCTTTGTCCTCAGCAAAC -3'
(R):5'- AAGAGATATCCCAGTTGCCCTC -3'

Sequencing Primer
(F):5'- TTTGTCCTCAGCAAACCCCAGAG -3'
(R):5'- AAGGATGCTGGGCCACTCTG -3'
Posted On2016-07-22