Incidental Mutation 'R5294:Taf5l'
ID 405311
Institutional Source Beutler Lab
Gene Symbol Taf5l
Ensembl Gene ENSMUSG00000038697
Gene Name TATA-box binding protein associated factor 5 like
Synonyms 1110005N04Rik
MMRRC Submission 042877-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R5294 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 124723057-124748136 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124734957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 74 (F74L)
Ref Sequence ENSEMBL: ENSMUSP00000128710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093039] [ENSMUST00000127664] [ENSMUST00000165628] [ENSMUST00000212010]
AlphaFold Q91WQ5
Predicted Effect probably benign
Transcript: ENSMUST00000093039
AA Change: F74L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090726
Gene: ENSMUSG00000038697
AA Change: F74L

DomainStartEndE-ValueType
Pfam:TFIID_NTD2 61 195 8.4e-35 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165628
AA Change: F74L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128710
Gene: ENSMUSG00000038697
AA Change: F74L

DomainStartEndE-ValueType
Pfam:TFIID_90kDa 55 196 1.2e-43 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211825
Predicted Effect probably benign
Transcript: ENSMUST00000212010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213055
Meta Mutation Damage Score 0.1470 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,034,056 (GRCm39) noncoding transcript Het
Acaca A G 11: 84,282,345 (GRCm39) E2154G probably benign Het
Acacb T C 5: 114,380,013 (GRCm39) F2056L probably damaging Het
Aff1 A G 5: 103,959,023 (GRCm39) probably benign Het
Amn1 T A 6: 149,086,622 (GRCm39) probably benign Het
Arid1a C A 4: 133,418,366 (GRCm39) probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Asxl3 T A 18: 22,649,496 (GRCm39) V495D possibly damaging Het
Atp1a3 T A 7: 24,687,473 (GRCm39) H688L probably damaging Het
B3gnt8 T C 7: 25,328,191 (GRCm39) L207P probably damaging Het
Baz2b T C 2: 59,808,946 (GRCm39) H101R probably benign Het
Bicc1 G A 10: 70,783,730 (GRCm39) T387M possibly damaging Het
Champ1 A C 8: 13,928,981 (GRCm39) K380Q probably damaging Het
Cnst A G 1: 179,438,005 (GRCm39) E523G probably benign Het
Cops6 G C 5: 138,159,378 (GRCm39) probably benign Het
Cp G C 3: 20,020,480 (GRCm39) V158L probably benign Het
Cyfip1 T A 7: 55,523,231 (GRCm39) M52K possibly damaging Het
Dars1 A T 1: 128,292,039 (GRCm39) F480I probably benign Het
Diaph1 C A 18: 38,030,603 (GRCm39) E284* probably null Het
Diaph1 T C 18: 38,030,633 (GRCm39) M274V unknown Het
Dock8 G A 19: 25,038,517 (GRCm39) V68M probably benign Het
Elavl4 A G 4: 110,068,627 (GRCm39) F247L possibly damaging Het
Emc10 C T 7: 44,145,863 (GRCm39) probably benign Het
Fbxw16 T C 9: 109,265,712 (GRCm39) D369G probably benign Het
Fgr A T 4: 132,724,811 (GRCm39) D304V probably benign Het
Filip1l G A 16: 57,390,399 (GRCm39) S91N possibly damaging Het
Haus8 A G 8: 71,708,354 (GRCm39) S103P unknown Het
Hscb A G 5: 110,982,658 (GRCm39) L143P probably damaging Het
Hsd11b2 A T 8: 106,249,929 (GRCm39) M347L probably benign Het
Jrk C A 15: 74,579,185 (GRCm39) E33D possibly damaging Het
Kbtbd8 T A 6: 95,098,813 (GRCm39) Y123* probably null Het
Lrrc37 A G 11: 103,507,057 (GRCm39) probably benign Het
Mis18bp1 A C 12: 65,203,817 (GRCm39) M59R probably damaging Het
Mrps27 T C 13: 99,546,381 (GRCm39) V260A probably damaging Het
Ncapg2 G T 12: 116,391,414 (GRCm39) V488L possibly damaging Het
Nepn A T 10: 52,276,896 (GRCm39) N211Y probably benign Het
Ntrk3 A T 7: 78,167,254 (GRCm39) probably null Het
Or10x4 A T 1: 174,218,791 (GRCm39) Y52F probably benign Het
Or11h23 A G 14: 50,947,900 (GRCm39) T38A possibly damaging Het
Or11h23 A G 14: 50,948,236 (GRCm39) I150V probably benign Het
Or52w1 C T 7: 105,017,620 (GRCm39) T20I probably benign Het
Otud4 A T 8: 80,399,521 (GRCm39) Q744L possibly damaging Het
P2ry14 A T 3: 59,022,989 (GRCm39) I166N possibly damaging Het
Pak2 T A 16: 31,840,648 (GRCm39) N478Y probably damaging Het
Papss2 A G 19: 32,616,400 (GRCm39) D202G probably benign Het
Pcdh7 C A 5: 57,885,453 (GRCm39) probably null Het
Peg3 C A 7: 6,720,848 (GRCm39) S19I possibly damaging Het
Prim2 G T 1: 33,707,974 (GRCm39) T40K probably benign Het
Ranbp2 T C 10: 58,314,490 (GRCm39) F1737L probably benign Het
Rex2 A C 4: 147,142,442 (GRCm39) N310T probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf39 C T 17: 37,258,092 (GRCm39) A86V probably damaging Het
Ror1 A T 4: 100,283,135 (GRCm39) N400I probably benign Het
Slc38a8 C T 8: 120,221,028 (GRCm39) G177D probably damaging Het
Slc43a3 T C 2: 84,786,654 (GRCm39) V445A probably benign Het
Sptbn2 A G 19: 4,768,936 (GRCm39) N23S possibly damaging Het
Trappc11 G C 8: 47,983,766 (GRCm39) A42G possibly damaging Het
Trim30d T C 7: 104,121,695 (GRCm39) K350R probably damaging Het
Trnt1 T C 6: 106,750,375 (GRCm39) F93S probably damaging Het
Ube2c T C 2: 164,619,110 (GRCm39) V161A probably benign Het
Usp24 A G 4: 106,219,554 (GRCm39) E555G possibly damaging Het
Vmn2r55 T G 7: 12,385,791 (GRCm39) S730R probably damaging Het
Vmn2r89 T A 14: 51,692,570 (GRCm39) N124K probably benign Het
Vmn2r98 T A 17: 19,290,016 (GRCm39) C517* probably null Het
Vps13a A T 19: 16,619,031 (GRCm39) I2845N probably damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Xpo5 T C 17: 46,547,848 (GRCm39) V896A probably benign Het
Zfp2 T C 11: 50,792,068 (GRCm39) probably benign Het
Zgrf1 G A 3: 127,394,629 (GRCm39) M1328I probably benign Het
Zswim5 A G 4: 116,836,774 (GRCm39) D686G possibly damaging Het
Other mutations in Taf5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Taf5l APN 8 124,730,197 (GRCm39) missense possibly damaging 0.94
IGL03371:Taf5l APN 8 124,724,725 (GRCm39) missense possibly damaging 0.52
Invalid UTSW 8 124,729,714 (GRCm39) critical splice donor site probably null
R0017:Taf5l UTSW 8 124,730,383 (GRCm39) missense probably damaging 1.00
R1708:Taf5l UTSW 8 124,736,509 (GRCm39) nonsense probably null
R1813:Taf5l UTSW 8 124,730,152 (GRCm39) missense probably damaging 1.00
R1861:Taf5l UTSW 8 124,724,729 (GRCm39) missense probably damaging 1.00
R1896:Taf5l UTSW 8 124,730,152 (GRCm39) missense probably damaging 1.00
R4570:Taf5l UTSW 8 124,724,289 (GRCm39) missense probably damaging 1.00
R4656:Taf5l UTSW 8 124,724,844 (GRCm39) missense probably benign
R5335:Taf5l UTSW 8 124,730,390 (GRCm39) missense probably damaging 1.00
R5480:Taf5l UTSW 8 124,736,559 (GRCm39) missense possibly damaging 0.78
R5905:Taf5l UTSW 8 124,729,714 (GRCm39) critical splice donor site probably null
R6028:Taf5l UTSW 8 124,729,714 (GRCm39) critical splice donor site probably null
R7105:Taf5l UTSW 8 124,729,951 (GRCm39) missense probably damaging 1.00
R8304:Taf5l UTSW 8 124,730,251 (GRCm39) missense probably benign 0.03
R8337:Taf5l UTSW 8 124,724,841 (GRCm39) missense probably benign 0.00
R8881:Taf5l UTSW 8 124,730,101 (GRCm39) missense possibly damaging 0.51
R9128:Taf5l UTSW 8 124,730,014 (GRCm39) missense probably benign
R9600:Taf5l UTSW 8 124,730,173 (GRCm39) missense
X0024:Taf5l UTSW 8 124,724,760 (GRCm39) missense probably benign 0.04
Z1088:Taf5l UTSW 8 124,724,077 (GRCm39) nonsense probably null
Z1176:Taf5l UTSW 8 124,724,101 (GRCm39) missense probably benign 0.06
Z1177:Taf5l UTSW 8 124,729,738 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGGTGCCAAAAGCCACAG -3'
(R):5'- GTCCTAGAGACTACTGAGAGATGC -3'

Sequencing Primer
(F):5'- TAGGACAGGCAGAGTTCTCTATCC -3'
(R):5'- ACTACTGAGAGATGCCATTGTGCTC -3'
Posted On 2016-07-22