Incidental Mutation 'R5294:Taf5l'
ID405311
Institutional Source Beutler Lab
Gene Symbol Taf5l
Ensembl Gene ENSMUSG00000038697
Gene NameTATA-box binding protein associated factor 5 like
Synonyms
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123996318-124021397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124008218 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 74 (F74L)
Ref Sequence ENSEMBL: ENSMUSP00000128710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093039] [ENSMUST00000127664] [ENSMUST00000165628] [ENSMUST00000212010]
Predicted Effect probably benign
Transcript: ENSMUST00000093039
AA Change: F74L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090726
Gene: ENSMUSG00000038697
AA Change: F74L

DomainStartEndE-ValueType
Pfam:TFIID_NTD2 61 195 8.4e-35 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165628
AA Change: F74L

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128710
Gene: ENSMUSG00000038697
AA Change: F74L

DomainStartEndE-ValueType
Pfam:TFIID_90kDa 55 196 1.2e-43 PFAM
WD40 257 296 6.66e-1 SMART
WD40 331 370 3.19e-7 SMART
WD40 373 412 5.95e-7 SMART
WD40 415 454 2.2e-10 SMART
WD40 457 496 1.2e-11 SMART
WD40 499 538 5.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211825
Predicted Effect probably benign
Transcript: ENSMUST00000212010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213055
Meta Mutation Damage Score 0.1470 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the WD-repeat TAF5 family of proteins. This gene encodes a protein that is a component of the PCAF histone acetylase complex. The PCAF histone acetylase complex, which is composed of more than 20 polypeptides some of which are TAFs, is required for myogenic transcription and differentiation. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors to facilitate complex assembly and transcription initiation. The encoded protein is structurally similar to one of the histone-like TAFs, TAF5. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Taf5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02850:Taf5l APN 8 124003458 missense possibly damaging 0.94
IGL03371:Taf5l APN 8 123997986 missense possibly damaging 0.52
Invalid UTSW 8 124002975 critical splice donor site probably null
R0017:Taf5l UTSW 8 124003644 missense probably damaging 1.00
R1708:Taf5l UTSW 8 124009770 nonsense probably null
R1813:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R1861:Taf5l UTSW 8 123997990 missense probably damaging 1.00
R1896:Taf5l UTSW 8 124003413 missense probably damaging 1.00
R4570:Taf5l UTSW 8 123997550 missense probably damaging 1.00
R4656:Taf5l UTSW 8 123998105 missense probably benign
R5335:Taf5l UTSW 8 124003651 missense probably damaging 1.00
R5480:Taf5l UTSW 8 124009820 missense possibly damaging 0.78
R5905:Taf5l UTSW 8 124002975 critical splice donor site probably null
R6028:Taf5l UTSW 8 124002975 critical splice donor site probably null
R7105:Taf5l UTSW 8 124003212 missense probably damaging 1.00
R8304:Taf5l UTSW 8 124003512 missense probably benign 0.03
X0024:Taf5l UTSW 8 123998021 missense probably benign 0.04
Z1088:Taf5l UTSW 8 123997338 nonsense probably null
Z1176:Taf5l UTSW 8 123997362 missense probably benign 0.06
Z1177:Taf5l UTSW 8 124002999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGGTGCCAAAAGCCACAG -3'
(R):5'- GTCCTAGAGACTACTGAGAGATGC -3'

Sequencing Primer
(F):5'- TAGGACAGGCAGAGTTCTCTATCC -3'
(R):5'- ACTACTGAGAGATGCCATTGTGCTC -3'
Posted On2016-07-22