Incidental Mutation 'R5294:Rnf123'
ID 405314
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission 042877-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.171) question?
Stock # R5294 (G1)
Quality Score 217
Status Validated
Chromosome 9
Chromosomal Location 107928869-107957183 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AT to ATT at 107941202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000178267] [ENSMUST00000162753]
AlphaFold Q5XPI3
Predicted Effect probably null
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably null
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,034,056 (GRCm39) noncoding transcript Het
Acaca A G 11: 84,282,345 (GRCm39) E2154G probably benign Het
Acacb T C 5: 114,380,013 (GRCm39) F2056L probably damaging Het
Aff1 A G 5: 103,959,023 (GRCm39) probably benign Het
Amn1 T A 6: 149,086,622 (GRCm39) probably benign Het
Arid1a C A 4: 133,418,366 (GRCm39) probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Asxl3 T A 18: 22,649,496 (GRCm39) V495D possibly damaging Het
Atp1a3 T A 7: 24,687,473 (GRCm39) H688L probably damaging Het
B3gnt8 T C 7: 25,328,191 (GRCm39) L207P probably damaging Het
Baz2b T C 2: 59,808,946 (GRCm39) H101R probably benign Het
Bicc1 G A 10: 70,783,730 (GRCm39) T387M possibly damaging Het
Champ1 A C 8: 13,928,981 (GRCm39) K380Q probably damaging Het
Cnst A G 1: 179,438,005 (GRCm39) E523G probably benign Het
Cops6 G C 5: 138,159,378 (GRCm39) probably benign Het
Cp G C 3: 20,020,480 (GRCm39) V158L probably benign Het
Cyfip1 T A 7: 55,523,231 (GRCm39) M52K possibly damaging Het
Dars1 A T 1: 128,292,039 (GRCm39) F480I probably benign Het
Diaph1 C A 18: 38,030,603 (GRCm39) E284* probably null Het
Diaph1 T C 18: 38,030,633 (GRCm39) M274V unknown Het
Dock8 G A 19: 25,038,517 (GRCm39) V68M probably benign Het
Elavl4 A G 4: 110,068,627 (GRCm39) F247L possibly damaging Het
Emc10 C T 7: 44,145,863 (GRCm39) probably benign Het
Fbxw16 T C 9: 109,265,712 (GRCm39) D369G probably benign Het
Fgr A T 4: 132,724,811 (GRCm39) D304V probably benign Het
Filip1l G A 16: 57,390,399 (GRCm39) S91N possibly damaging Het
Haus8 A G 8: 71,708,354 (GRCm39) S103P unknown Het
Hscb A G 5: 110,982,658 (GRCm39) L143P probably damaging Het
Hsd11b2 A T 8: 106,249,929 (GRCm39) M347L probably benign Het
Jrk C A 15: 74,579,185 (GRCm39) E33D possibly damaging Het
Kbtbd8 T A 6: 95,098,813 (GRCm39) Y123* probably null Het
Lrrc37 A G 11: 103,507,057 (GRCm39) probably benign Het
Mis18bp1 A C 12: 65,203,817 (GRCm39) M59R probably damaging Het
Mrps27 T C 13: 99,546,381 (GRCm39) V260A probably damaging Het
Ncapg2 G T 12: 116,391,414 (GRCm39) V488L possibly damaging Het
Nepn A T 10: 52,276,896 (GRCm39) N211Y probably benign Het
Ntrk3 A T 7: 78,167,254 (GRCm39) probably null Het
Or10x4 A T 1: 174,218,791 (GRCm39) Y52F probably benign Het
Or11h23 A G 14: 50,947,900 (GRCm39) T38A possibly damaging Het
Or11h23 A G 14: 50,948,236 (GRCm39) I150V probably benign Het
Or52w1 C T 7: 105,017,620 (GRCm39) T20I probably benign Het
Otud4 A T 8: 80,399,521 (GRCm39) Q744L possibly damaging Het
P2ry14 A T 3: 59,022,989 (GRCm39) I166N possibly damaging Het
Pak2 T A 16: 31,840,648 (GRCm39) N478Y probably damaging Het
Papss2 A G 19: 32,616,400 (GRCm39) D202G probably benign Het
Pcdh7 C A 5: 57,885,453 (GRCm39) probably null Het
Peg3 C A 7: 6,720,848 (GRCm39) S19I possibly damaging Het
Prim2 G T 1: 33,707,974 (GRCm39) T40K probably benign Het
Ranbp2 T C 10: 58,314,490 (GRCm39) F1737L probably benign Het
Rex2 A C 4: 147,142,442 (GRCm39) N310T probably benign Het
Rnf39 C T 17: 37,258,092 (GRCm39) A86V probably damaging Het
Ror1 A T 4: 100,283,135 (GRCm39) N400I probably benign Het
Slc38a8 C T 8: 120,221,028 (GRCm39) G177D probably damaging Het
Slc43a3 T C 2: 84,786,654 (GRCm39) V445A probably benign Het
Sptbn2 A G 19: 4,768,936 (GRCm39) N23S possibly damaging Het
Taf5l A G 8: 124,734,957 (GRCm39) F74L probably benign Het
Trappc11 G C 8: 47,983,766 (GRCm39) A42G possibly damaging Het
Trim30d T C 7: 104,121,695 (GRCm39) K350R probably damaging Het
Trnt1 T C 6: 106,750,375 (GRCm39) F93S probably damaging Het
Ube2c T C 2: 164,619,110 (GRCm39) V161A probably benign Het
Usp24 A G 4: 106,219,554 (GRCm39) E555G possibly damaging Het
Vmn2r55 T G 7: 12,385,791 (GRCm39) S730R probably damaging Het
Vmn2r89 T A 14: 51,692,570 (GRCm39) N124K probably benign Het
Vmn2r98 T A 17: 19,290,016 (GRCm39) C517* probably null Het
Vps13a A T 19: 16,619,031 (GRCm39) I2845N probably damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Xpo5 T C 17: 46,547,848 (GRCm39) V896A probably benign Het
Zfp2 T C 11: 50,792,068 (GRCm39) probably benign Het
Zgrf1 G A 3: 127,394,629 (GRCm39) M1328I probably benign Het
Zswim5 A G 4: 116,836,774 (GRCm39) D686G possibly damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 107,944,594 (GRCm39) critical splice donor site probably null
IGL01358:Rnf123 APN 9 107,946,381 (GRCm39) missense probably damaging 1.00
IGL01464:Rnf123 APN 9 107,929,501 (GRCm39) missense probably damaging 1.00
IGL01637:Rnf123 APN 9 107,935,437 (GRCm39) missense probably damaging 1.00
IGL01669:Rnf123 APN 9 107,935,555 (GRCm39) missense probably damaging 0.98
IGL01905:Rnf123 APN 9 107,948,569 (GRCm39) splice site probably benign
IGL02070:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02072:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02073:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02074:Rnf123 APN 9 107,944,088 (GRCm39) missense probably damaging 1.00
IGL02079:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02080:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02231:Rnf123 APN 9 107,943,598 (GRCm39) missense probably benign 0.17
IGL02281:Rnf123 APN 9 107,948,651 (GRCm39) missense probably benign 0.01
IGL02336:Rnf123 APN 9 107,939,041 (GRCm39) missense probably damaging 1.00
IGL02543:Rnf123 APN 9 107,943,547 (GRCm39) missense probably damaging 1.00
IGL02565:Rnf123 APN 9 107,929,411 (GRCm39) critical splice donor site probably null
IGL02571:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02572:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02574:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02586:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02589:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02600:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02601:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02602:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02603:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02609:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02628:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02629:Rnf123 APN 9 107,947,988 (GRCm39) splice site probably benign
IGL02629:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02630:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02631:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02632:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02650:Rnf123 APN 9 107,946,947 (GRCm39) missense probably benign 0.29
IGL02690:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02691:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02692:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02693:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02713:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02736:Rnf123 APN 9 107,945,501 (GRCm39) nonsense probably null
IGL02929:Rnf123 APN 9 107,946,275 (GRCm39) missense probably benign
R1175:Rnf123 UTSW 9 107,954,572 (GRCm39) missense probably benign
R1465:Rnf123 UTSW 9 107,948,665 (GRCm39) splice site probably benign
R1502:Rnf123 UTSW 9 107,945,709 (GRCm39) splice site probably null
R1682:Rnf123 UTSW 9 107,954,597 (GRCm39) missense probably benign 0.16
R1817:Rnf123 UTSW 9 107,940,125 (GRCm39) missense probably benign 0.41
R1855:Rnf123 UTSW 9 107,938,990 (GRCm39) missense probably damaging 1.00
R2394:Rnf123 UTSW 9 107,940,735 (GRCm39) missense probably benign 0.00
R2483:Rnf123 UTSW 9 107,940,720 (GRCm39) missense probably benign 0.16
R3896:Rnf123 UTSW 9 107,946,302 (GRCm39) splice site probably benign
R3940:Rnf123 UTSW 9 107,941,234 (GRCm39) splice site probably benign
R4206:Rnf123 UTSW 9 107,941,162 (GRCm39) missense probably benign 0.01
R4641:Rnf123 UTSW 9 107,935,786 (GRCm39) missense probably damaging 1.00
R4714:Rnf123 UTSW 9 107,929,638 (GRCm39) splice site probably null
R4767:Rnf123 UTSW 9 107,929,288 (GRCm39) missense probably damaging 1.00
R4849:Rnf123 UTSW 9 107,933,290 (GRCm39) missense probably damaging 1.00
R4899:Rnf123 UTSW 9 107,940,879 (GRCm39) missense probably damaging 1.00
R5274:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5275:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5276:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5295:Rnf123 UTSW 9 107,941,202 (GRCm39) frame shift probably null
R5394:Rnf123 UTSW 9 107,947,930 (GRCm39) missense probably damaging 1.00
R5717:Rnf123 UTSW 9 107,944,623 (GRCm39) missense probably damaging 1.00
R6186:Rnf123 UTSW 9 107,947,157 (GRCm39) missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 107,933,252 (GRCm39) missense probably benign 0.17
R6502:Rnf123 UTSW 9 107,945,531 (GRCm39) missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 107,940,822 (GRCm39) missense probably benign 0.02
R7003:Rnf123 UTSW 9 107,940,882 (GRCm39) critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 107,935,735 (GRCm39) missense probably null 1.00
R7092:Rnf123 UTSW 9 107,945,799 (GRCm39) missense probably benign 0.07
R7100:Rnf123 UTSW 9 107,933,838 (GRCm39) missense probably damaging 1.00
R7257:Rnf123 UTSW 9 107,946,228 (GRCm39) missense probably damaging 1.00
R7453:Rnf123 UTSW 9 107,947,607 (GRCm39) splice site probably null
R7468:Rnf123 UTSW 9 107,946,208 (GRCm39) missense probably benign 0.00
R7517:Rnf123 UTSW 9 107,947,473 (GRCm39) nonsense probably null
R7577:Rnf123 UTSW 9 107,947,818 (GRCm39) missense probably damaging 1.00
R8296:Rnf123 UTSW 9 107,940,089 (GRCm39) missense probably damaging 1.00
R8322:Rnf123 UTSW 9 107,945,706 (GRCm39) missense probably benign 0.26
R8754:Rnf123 UTSW 9 107,948,363 (GRCm39) missense probably damaging 1.00
R8783:Rnf123 UTSW 9 107,946,272 (GRCm39) missense probably benign
R9052:Rnf123 UTSW 9 107,936,930 (GRCm39) missense probably damaging 1.00
R9156:Rnf123 UTSW 9 107,940,227 (GRCm39) splice site probably benign
R9170:Rnf123 UTSW 9 107,948,375 (GRCm39) missense probably damaging 1.00
R9332:Rnf123 UTSW 9 107,944,704 (GRCm39) missense probably benign 0.00
R9385:Rnf123 UTSW 9 107,929,467 (GRCm39) missense probably benign 0.02
R9394:Rnf123 UTSW 9 107,942,905 (GRCm39) missense probably damaging 1.00
R9432:Rnf123 UTSW 9 107,937,008 (GRCm39) missense probably damaging 0.96
R9717:Rnf123 UTSW 9 107,954,963 (GRCm39) missense probably benign 0.43
Z1176:Rnf123 UTSW 9 107,940,180 (GRCm39) missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 107,935,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCTACACGGAGAGAAG -3'
(R):5'- CATGGGGCTCTCTAATGAGG -3'

Sequencing Primer
(F):5'- AAGCCGGACCTGGGTCATAC -3'
(R):5'- GGCCCTCTGAGATGTAGACAG -3'
Posted On 2016-07-22