Incidental Mutation 'R5294:Ranbp2'
ID405317
Institutional Source Beutler Lab
Gene Symbol Ranbp2
Ensembl Gene ENSMUSG00000003226
Gene NameRAN binding protein 2
SynonymsA430087B05Rik
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58446920-58494356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58478668 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1737 (F1737L)
Ref Sequence ENSEMBL: ENSMUSP00000003310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003310]
Predicted Effect probably benign
Transcript: ENSMUST00000003310
AA Change: F1737L

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003310
Gene: ENSMUSG00000003226
AA Change: F1737L

DomainStartEndE-ValueType
Pfam:TPR_1 60 93 1.8e-7 PFAM
Pfam:TPR_8 60 93 8.9e-6 PFAM
low complexity region 235 247 N/A INTRINSIC
low complexity region 778 801 N/A INTRINSIC
coiled coil region 808 832 N/A INTRINSIC
RanBD 1166 1295 6.47e-64 SMART
ZnF_RBZ 1348 1372 5.49e-2 SMART
ZnF_RBZ 1412 1436 3.06e-6 SMART
ZnF_RBZ 1471 1495 4.16e-8 SMART
ZnF_RBZ 1500 1524 4.57e-5 SMART
ZnF_RBZ 1560 1584 3.52e-6 SMART
ZnF_RBZ 1619 1643 1.35e-7 SMART
RanBD 1850 1979 2.84e-60 SMART
low complexity region 2034 2048 N/A INTRINSIC
low complexity region 2069 2090 N/A INTRINSIC
low complexity region 2106 2121 N/A INTRINSIC
RanBD 2147 2276 4.96e-83 SMART
low complexity region 2310 2317 N/A INTRINSIC
low complexity region 2328 2342 N/A INTRINSIC
Pfam:IR1-M 2468 2530 2.5e-27 PFAM
Pfam:IR1-M 2544 2604 7e-30 PFAM
low complexity region 2673 2684 N/A INTRINSIC
low complexity region 2722 2732 N/A INTRINSIC
RanBD 2741 2869 5e-79 SMART
Pfam:Pro_isomerase 2896 3052 4.5e-45 PFAM
Meta Mutation Damage Score 0.1715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice on some backgrounds display reduced ATP levels in the CNS, decreased glucose clearance, decreased weight gain on a high fat diet, and reduced scotopic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Ranbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ranbp2 APN 10 58477256 missense probably damaging 1.00
IGL00336:Ranbp2 APN 10 58451984 missense probably damaging 1.00
IGL00486:Ranbp2 APN 10 58477612 missense probably benign 0.06
IGL00800:Ranbp2 APN 10 58490704 missense probably benign
IGL00834:Ranbp2 APN 10 58453323 missense possibly damaging 0.94
IGL00852:Ranbp2 APN 10 58477901 missense probably benign
IGL00984:Ranbp2 APN 10 58461964 nonsense probably null
IGL01299:Ranbp2 APN 10 58492817 missense probably damaging 1.00
IGL01325:Ranbp2 APN 10 58476298 missense probably damaging 0.99
IGL01444:Ranbp2 APN 10 58475300 missense possibly damaging 0.79
IGL01545:Ranbp2 APN 10 58478881 missense possibly damaging 0.48
IGL01619:Ranbp2 APN 10 58464078 splice site probably null
IGL01782:Ranbp2 APN 10 58478309 missense probably damaging 0.97
IGL02020:Ranbp2 APN 10 58479947 missense probably damaging 1.00
IGL02096:Ranbp2 APN 10 58461967 missense probably damaging 1.00
IGL02182:Ranbp2 APN 10 58485760 nonsense probably null
IGL02211:Ranbp2 APN 10 58478242 missense probably benign
IGL02249:Ranbp2 APN 10 58480078 missense possibly damaging 0.89
IGL02268:Ranbp2 APN 10 58493653 unclassified probably benign
IGL02421:Ranbp2 APN 10 58480554 missense probably damaging 1.00
IGL03080:Ranbp2 APN 10 58476791 missense probably benign 0.01
IGL03119:Ranbp2 APN 10 58452003 missense probably damaging 1.00
IGL03206:Ranbp2 APN 10 58465547 missense probably damaging 1.00
IGL03237:Ranbp2 APN 10 58492961 missense probably damaging 0.98
En_passant UTSW 10 58452017 missense probably damaging 1.00
red_river UTSW 10 58465667 missense probably damaging 1.00
IGL02799:Ranbp2 UTSW 10 58480264 missense probably damaging 1.00
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0058:Ranbp2 UTSW 10 58480531 missense probably damaging 0.98
R0145:Ranbp2 UTSW 10 58480046 missense probably damaging 1.00
R0309:Ranbp2 UTSW 10 58479868 missense probably benign 0.04
R0375:Ranbp2 UTSW 10 58477283 missense probably damaging 1.00
R0441:Ranbp2 UTSW 10 58485768 missense probably benign 0.40
R0494:Ranbp2 UTSW 10 58467432 missense possibly damaging 0.53
R0542:Ranbp2 UTSW 10 58478414 missense probably benign 0.02
R0565:Ranbp2 UTSW 10 58476336 missense probably benign 0.41
R0608:Ranbp2 UTSW 10 58493898 missense probably damaging 1.00
R0661:Ranbp2 UTSW 10 58478733 missense probably benign
R0670:Ranbp2 UTSW 10 58480698 missense probably benign 0.01
R0760:Ranbp2 UTSW 10 58476791 missense possibly damaging 0.70
R0811:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R0812:Ranbp2 UTSW 10 58465529 missense probably benign 0.01
R1180:Ranbp2 UTSW 10 58465463 missense probably damaging 1.00
R1196:Ranbp2 UTSW 10 58477053 missense probably damaging 1.00
R1216:Ranbp2 UTSW 10 58483212 splice site probably benign
R1374:Ranbp2 UTSW 10 58485893 splice site probably benign
R1541:Ranbp2 UTSW 10 58483094 missense possibly damaging 0.90
R1589:Ranbp2 UTSW 10 58463986 missense probably benign 0.01
R1711:Ranbp2 UTSW 10 58460519 missense probably benign 0.11
R1761:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R1831:Ranbp2 UTSW 10 58479222 nonsense probably null
R1840:Ranbp2 UTSW 10 58478766 missense probably benign 0.41
R1869:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1871:Ranbp2 UTSW 10 58492561 missense probably damaging 1.00
R1892:Ranbp2 UTSW 10 58464099 missense probably benign 0.36
R2270:Ranbp2 UTSW 10 58455927 missense probably benign 0.06
R2363:Ranbp2 UTSW 10 58478936 missense possibly damaging 0.79
R3844:Ranbp2 UTSW 10 58477895 missense possibly damaging 0.87
R3937:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R3938:Ranbp2 UTSW 10 58476472 missense probably benign 0.00
R4025:Ranbp2 UTSW 10 58480556 missense probably benign 0.23
R4183:Ranbp2 UTSW 10 58465666 missense possibly damaging 0.53
R4247:Ranbp2 UTSW 10 58478864 missense possibly damaging 0.79
R4334:Ranbp2 UTSW 10 58463994 missense probably damaging 1.00
R4656:Ranbp2 UTSW 10 58453422 missense possibly damaging 0.82
R4746:Ranbp2 UTSW 10 58492670 missense probably damaging 1.00
R4852:Ranbp2 UTSW 10 58477056 missense possibly damaging 0.94
R4863:Ranbp2 UTSW 10 58492421 missense probably damaging 0.99
R5011:Ranbp2 UTSW 10 58461895 missense probably benign 0.36
R5014:Ranbp2 UTSW 10 58464120 missense probably benign 0.40
R5145:Ranbp2 UTSW 10 58480038 missense probably damaging 1.00
R5178:Ranbp2 UTSW 10 58476785 missense probably benign 0.01
R5199:Ranbp2 UTSW 10 58464443 missense probably benign
R5508:Ranbp2 UTSW 10 58480005 missense probably damaging 0.97
R5511:Ranbp2 UTSW 10 58493739 missense probably benign 0.29
R5575:Ranbp2 UTSW 10 58492583 missense probably damaging 1.00
R5617:Ranbp2 UTSW 10 58465667 missense probably damaging 1.00
R5630:Ranbp2 UTSW 10 58479076 missense probably damaging 1.00
R5733:Ranbp2 UTSW 10 58485836 missense probably damaging 1.00
R5751:Ranbp2 UTSW 10 58464264 splice site probably null
R5767:Ranbp2 UTSW 10 58476825 missense probably benign 0.02
R6122:Ranbp2 UTSW 10 58465529 missense probably benign 0.02
R6147:Ranbp2 UTSW 10 58479428 missense probably damaging 1.00
R6286:Ranbp2 UTSW 10 58479572 missense probably benign 0.02
R6344:Ranbp2 UTSW 10 58483886 splice site probably null
R6452:Ranbp2 UTSW 10 58478157 missense probably benign 0.00
R6487:Ranbp2 UTSW 10 58485741 missense probably benign 0.02
R6620:Ranbp2 UTSW 10 58455807 critical splice acceptor site probably null
R6759:Ranbp2 UTSW 10 58457737 nonsense probably null
R7010:Ranbp2 UTSW 10 58454571 critical splice acceptor site probably null
R7071:Ranbp2 UTSW 10 58492837 missense probably damaging 1.00
R7083:Ranbp2 UTSW 10 58479230 missense probably damaging 1.00
R7088:Ranbp2 UTSW 10 58463906 missense probably damaging 1.00
R7102:Ranbp2 UTSW 10 58463950 missense probably damaging 1.00
R7194:Ranbp2 UTSW 10 58476769 missense probably benign 0.05
R7217:Ranbp2 UTSW 10 58452017 missense probably damaging 1.00
R7318:Ranbp2 UTSW 10 58483087 nonsense probably null
R7341:Ranbp2 UTSW 10 58485797 missense possibly damaging 0.72
R7398:Ranbp2 UTSW 10 58467277 missense probably damaging 1.00
R7424:Ranbp2 UTSW 10 58479194 missense probably damaging 0.98
R7727:Ranbp2 UTSW 10 58455438 missense probably benign 0.09
R7795:Ranbp2 UTSW 10 58483907 nonsense probably null
R7812:Ranbp2 UTSW 10 58467402 missense probably benign
R7845:Ranbp2 UTSW 10 58447022 missense probably damaging 1.00
R7875:Ranbp2 UTSW 10 58478455 nonsense probably null
R7958:Ranbp2 UTSW 10 58478455 nonsense probably null
R8022:Ranbp2 UTSW 10 58485861 missense possibly damaging 0.53
R8050:Ranbp2 UTSW 10 58479619 missense probably damaging 0.99
X0018:Ranbp2 UTSW 10 58478584 missense probably benign 0.13
X0022:Ranbp2 UTSW 10 58465155 missense probably benign 0.33
Z1088:Ranbp2 UTSW 10 58477972 frame shift probably null
Z1088:Ranbp2 UTSW 10 58477983 frame shift probably null
Z1088:Ranbp2 UTSW 10 58492893 missense probably benign 0.35
Z1176:Ranbp2 UTSW 10 58461886 missense probably damaging 1.00
Z1177:Ranbp2 UTSW 10 58493891 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCAGGAAGTCAAGTGGG -3'
(R):5'- GTCTTTCTTGCCAAATTGAAACCC -3'

Sequencing Primer
(F):5'- GGAACAGAATTCAAAAGTAACTTTCC -3'
(R):5'- GCCAAATTGAAACCCTTCTCTTGATG -3'
Posted On2016-07-22