Incidental Mutation 'R5294:Bicc1'
ID405318
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70947900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 387 (T387M)
Ref Sequence ENSEMBL: ENSMUSP00000119137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014473
AA Change: T469M

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T469M

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131445
AA Change: T387M

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T387M

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000143791
AA Change: T469M

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T469M

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
R8129:Bicc1 UTSW 10 71079203 missense probably benign 0.01
R8270:Bicc1 UTSW 10 70932108 missense probably damaging 0.99
R8525:Bicc1 UTSW 10 70943535 missense possibly damaging 0.67
R8762:Bicc1 UTSW 10 70943386 missense probably benign 0.03
R8849:Bicc1 UTSW 10 70946864 missense probably benign 0.23
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGTATCTATGAATTCCCACTTC -3'
(R):5'- GGCAAGATTTCACGGGAATATC -3'

Sequencing Primer
(F):5'- CTTGATGCTTTAAGGGGCACTAACC -3'
(R):5'- TCACGGGAATATCTGAAATAACATC -3'
Posted On2016-07-22