Incidental Mutation 'R0497:Med25'
ID40532
Institutional Source Beutler Lab
Gene Symbol Med25
Ensembl Gene ENSMUSG00000002968
Gene Namemediator complex subunit 25
Synonyms2610529E18Rik, 2610034E13Rik, ESTM2
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0497 (G1)
Quality Score200
Status Validated
Chromosome7
Chromosomal Location44876765-44892712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44892100 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 60 (D60G)
Ref Sequence ENSEMBL: ENSMUSP00000146475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003049] [ENSMUST00000071207] [ENSMUST00000207069] [ENSMUST00000207154] [ENSMUST00000207278] [ENSMUST00000207485] [ENSMUST00000207654] [ENSMUST00000207788] [ENSMUST00000207939] [ENSMUST00000208179] [ENSMUST00000208253] [ENSMUST00000208551] [ENSMUST00000208556] [ENSMUST00000208600] [ENSMUST00000209039] [ENSMUST00000209132]
Predicted Effect probably benign
Transcript: ENSMUST00000003049
AA Change: D60G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003049
Gene: ENSMUSG00000002968
AA Change: D60G

DomainStartEndE-ValueType
VWA 15 178 6.55e0 SMART
low complexity region 193 211 N/A INTRINSIC
Pfam:Med25_SD1 228 383 5.8e-55 PFAM
Pfam:Med25 396 546 3.9e-64 PFAM
low complexity region 577 592 N/A INTRINSIC
low complexity region 596 632 N/A INTRINSIC
Pfam:Med25_NR-box 657 745 5.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071207
SMART Domains Protein: ENSMUSP00000071194
Gene: ENSMUSG00000011658

DomainStartEndE-ValueType
low complexity region 234 259 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
low complexity region 382 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207069
Predicted Effect probably benign
Transcript: ENSMUST00000207154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207196
Predicted Effect probably benign
Transcript: ENSMUST00000207278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207480
Predicted Effect probably benign
Transcript: ENSMUST00000207485
Predicted Effect probably benign
Transcript: ENSMUST00000207490
Predicted Effect probably benign
Transcript: ENSMUST00000207654
AA Change: D60G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000207788
AA Change: D60G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000207939
Predicted Effect probably benign
Transcript: ENSMUST00000208179
Predicted Effect probably benign
Transcript: ENSMUST00000208253
AA Change: D60G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208484
Predicted Effect probably benign
Transcript: ENSMUST00000208551
AA Change: D60G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably damaging
Transcript: ENSMUST00000208556
AA Change: D60G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000208600
Predicted Effect probably benign
Transcript: ENSMUST00000208908
Predicted Effect probably benign
Transcript: ENSMUST00000209039
Predicted Effect probably benign
Transcript: ENSMUST00000209132
Meta Mutation Damage Score 0.1226 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the transcriptional coactivator complex termed the Mediator complex. This complex is required for transcription of most RNA polymerase II-dependent genes. The encoded protein plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Med25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Med25 APN 7 44882831 missense possibly damaging 0.86
IGL02963:Med25 APN 7 44892256 missense probably damaging 1.00
R0102:Med25 UTSW 7 44885480 missense possibly damaging 0.92
R0167:Med25 UTSW 7 44883097 critical splice donor site probably null
R0302:Med25 UTSW 7 44880558 unclassified probably benign
R0511:Med25 UTSW 7 44885078 critical splice donor site probably null
R1054:Med25 UTSW 7 44880380 missense probably benign 0.03
R1914:Med25 UTSW 7 44884622 missense probably benign 0.01
R2305:Med25 UTSW 7 44885890 missense possibly damaging 0.91
R2360:Med25 UTSW 7 44885142 missense probably damaging 1.00
R3436:Med25 UTSW 7 44885890 missense possibly damaging 0.91
R4736:Med25 UTSW 7 44892288 missense probably damaging 1.00
R4807:Med25 UTSW 7 44884619 missense probably benign 0.23
R4945:Med25 UTSW 7 44883102 missense possibly damaging 0.93
R5494:Med25 UTSW 7 44885801 missense probably damaging 1.00
R7037:Med25 UTSW 7 44882782 missense probably damaging 1.00
R7078:Med25 UTSW 7 44884901 missense probably damaging 1.00
R7411:Med25 UTSW 7 44878243 missense probably damaging 0.98
R7542:Med25 UTSW 7 44891791 missense probably damaging 0.96
R7883:Med25 UTSW 7 44891808 missense possibly damaging 0.77
R7966:Med25 UTSW 7 44891808 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACTGGGTTCCACCATACTGGGAAG -3'
(R):5'- ATCAGCATCAGCAGAAGCTGCC -3'

Sequencing Primer
(F):5'- TTCCACCATACTGGGAAGAAAGG -3'
(R):5'- GCAAGCGCACTTCTGTTCG -3'
Posted On2013-05-23