Incidental Mutation 'R5294:Asxl3'
ID 405334
Institutional Source Beutler Lab
Gene Symbol Asxl3
Ensembl Gene ENSMUSG00000045215
Gene Name ASXL transcriptional regulator 3
Synonyms D430002O22Rik, C230079D11Rik, LOC381127, D930044O18Rik
MMRRC Submission 042877-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.354) question?
Stock # R5294 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 22477303-22663284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22649496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 495 (V495D)
Ref Sequence ENSEMBL: ENSMUSP00000112793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000097655
AA Change: V495D

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: V495D

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 173 305 5.6e-50 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2139 2202 9.8e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120223
AA Change: V495D

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: V495D

DomainStartEndE-ValueType
low complexity region 98 112 N/A INTRINSIC
Pfam:ASXH 179 304 1.3e-36 PFAM
low complexity region 391 404 N/A INTRINSIC
low complexity region 667 686 N/A INTRINSIC
low complexity region 939 954 N/A INTRINSIC
low complexity region 978 988 N/A INTRINSIC
low complexity region 1002 1023 N/A INTRINSIC
low complexity region 1160 1168 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1681 1691 N/A INTRINSIC
SCOP:d1dnpa2 1946 1995 6e-3 SMART
low complexity region 2035 2050 N/A INTRINSIC
Pfam:PHD_3 2138 2202 1.9e-24 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,034,056 (GRCm39) noncoding transcript Het
Acaca A G 11: 84,282,345 (GRCm39) E2154G probably benign Het
Acacb T C 5: 114,380,013 (GRCm39) F2056L probably damaging Het
Aff1 A G 5: 103,959,023 (GRCm39) probably benign Het
Amn1 T A 6: 149,086,622 (GRCm39) probably benign Het
Arid1a C A 4: 133,418,366 (GRCm39) probably benign Het
Aste1 T A 9: 105,279,904 (GRCm39) probably null Het
Atp1a3 T A 7: 24,687,473 (GRCm39) H688L probably damaging Het
B3gnt8 T C 7: 25,328,191 (GRCm39) L207P probably damaging Het
Baz2b T C 2: 59,808,946 (GRCm39) H101R probably benign Het
Bicc1 G A 10: 70,783,730 (GRCm39) T387M possibly damaging Het
Champ1 A C 8: 13,928,981 (GRCm39) K380Q probably damaging Het
Cnst A G 1: 179,438,005 (GRCm39) E523G probably benign Het
Cops6 G C 5: 138,159,378 (GRCm39) probably benign Het
Cp G C 3: 20,020,480 (GRCm39) V158L probably benign Het
Cyfip1 T A 7: 55,523,231 (GRCm39) M52K possibly damaging Het
Dars1 A T 1: 128,292,039 (GRCm39) F480I probably benign Het
Diaph1 C A 18: 38,030,603 (GRCm39) E284* probably null Het
Diaph1 T C 18: 38,030,633 (GRCm39) M274V unknown Het
Dock8 G A 19: 25,038,517 (GRCm39) V68M probably benign Het
Elavl4 A G 4: 110,068,627 (GRCm39) F247L possibly damaging Het
Emc10 C T 7: 44,145,863 (GRCm39) probably benign Het
Fbxw16 T C 9: 109,265,712 (GRCm39) D369G probably benign Het
Fgr A T 4: 132,724,811 (GRCm39) D304V probably benign Het
Filip1l G A 16: 57,390,399 (GRCm39) S91N possibly damaging Het
Haus8 A G 8: 71,708,354 (GRCm39) S103P unknown Het
Hscb A G 5: 110,982,658 (GRCm39) L143P probably damaging Het
Hsd11b2 A T 8: 106,249,929 (GRCm39) M347L probably benign Het
Jrk C A 15: 74,579,185 (GRCm39) E33D possibly damaging Het
Kbtbd8 T A 6: 95,098,813 (GRCm39) Y123* probably null Het
Lrrc37 A G 11: 103,507,057 (GRCm39) probably benign Het
Mis18bp1 A C 12: 65,203,817 (GRCm39) M59R probably damaging Het
Mrps27 T C 13: 99,546,381 (GRCm39) V260A probably damaging Het
Ncapg2 G T 12: 116,391,414 (GRCm39) V488L possibly damaging Het
Nepn A T 10: 52,276,896 (GRCm39) N211Y probably benign Het
Ntrk3 A T 7: 78,167,254 (GRCm39) probably null Het
Or10x4 A T 1: 174,218,791 (GRCm39) Y52F probably benign Het
Or11h23 A G 14: 50,947,900 (GRCm39) T38A possibly damaging Het
Or11h23 A G 14: 50,948,236 (GRCm39) I150V probably benign Het
Or52w1 C T 7: 105,017,620 (GRCm39) T20I probably benign Het
Otud4 A T 8: 80,399,521 (GRCm39) Q744L possibly damaging Het
P2ry14 A T 3: 59,022,989 (GRCm39) I166N possibly damaging Het
Pak2 T A 16: 31,840,648 (GRCm39) N478Y probably damaging Het
Papss2 A G 19: 32,616,400 (GRCm39) D202G probably benign Het
Pcdh7 C A 5: 57,885,453 (GRCm39) probably null Het
Peg3 C A 7: 6,720,848 (GRCm39) S19I possibly damaging Het
Prim2 G T 1: 33,707,974 (GRCm39) T40K probably benign Het
Ranbp2 T C 10: 58,314,490 (GRCm39) F1737L probably benign Het
Rex2 A C 4: 147,142,442 (GRCm39) N310T probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf39 C T 17: 37,258,092 (GRCm39) A86V probably damaging Het
Ror1 A T 4: 100,283,135 (GRCm39) N400I probably benign Het
Slc38a8 C T 8: 120,221,028 (GRCm39) G177D probably damaging Het
Slc43a3 T C 2: 84,786,654 (GRCm39) V445A probably benign Het
Sptbn2 A G 19: 4,768,936 (GRCm39) N23S possibly damaging Het
Taf5l A G 8: 124,734,957 (GRCm39) F74L probably benign Het
Trappc11 G C 8: 47,983,766 (GRCm39) A42G possibly damaging Het
Trim30d T C 7: 104,121,695 (GRCm39) K350R probably damaging Het
Trnt1 T C 6: 106,750,375 (GRCm39) F93S probably damaging Het
Ube2c T C 2: 164,619,110 (GRCm39) V161A probably benign Het
Usp24 A G 4: 106,219,554 (GRCm39) E555G possibly damaging Het
Vmn2r55 T G 7: 12,385,791 (GRCm39) S730R probably damaging Het
Vmn2r89 T A 14: 51,692,570 (GRCm39) N124K probably benign Het
Vmn2r98 T A 17: 19,290,016 (GRCm39) C517* probably null Het
Vps13a A T 19: 16,619,031 (GRCm39) I2845N probably damaging Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Xpo5 T C 17: 46,547,848 (GRCm39) V896A probably benign Het
Zfp2 T C 11: 50,792,068 (GRCm39) probably benign Het
Zgrf1 G A 3: 127,394,629 (GRCm39) M1328I probably benign Het
Zswim5 A G 4: 116,836,774 (GRCm39) D686G possibly damaging Het
Other mutations in Asxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Asxl3 APN 18 22,658,280 (GRCm39) missense probably benign 0.41
IGL00510:Asxl3 APN 18 22,656,622 (GRCm39) missense probably damaging 1.00
IGL00864:Asxl3 APN 18 22,655,503 (GRCm39) missense probably benign 0.06
IGL01074:Asxl3 APN 18 22,655,902 (GRCm39) missense probably damaging 1.00
IGL01305:Asxl3 APN 18 22,649,503 (GRCm39) missense probably benign 0.06
IGL01313:Asxl3 APN 18 22,650,516 (GRCm39) missense probably benign 0.41
IGL01349:Asxl3 APN 18 22,657,294 (GRCm39) missense probably benign 0.28
IGL01529:Asxl3 APN 18 22,650,712 (GRCm39) missense probably damaging 1.00
IGL01574:Asxl3 APN 18 22,656,621 (GRCm39) missense probably benign 0.06
IGL01583:Asxl3 APN 18 22,649,654 (GRCm39) missense probably benign 0.01
IGL01619:Asxl3 APN 18 22,656,385 (GRCm39) missense probably damaging 1.00
IGL01720:Asxl3 APN 18 22,658,382 (GRCm39) missense probably damaging 1.00
IGL01816:Asxl3 APN 18 22,655,545 (GRCm39) missense probably benign 0.10
IGL01828:Asxl3 APN 18 22,658,615 (GRCm39) utr 3 prime probably benign
IGL01903:Asxl3 APN 18 22,567,633 (GRCm39) missense probably benign 0.00
IGL01906:Asxl3 APN 18 22,655,338 (GRCm39) missense probably benign 0.01
IGL01962:Asxl3 APN 18 22,655,502 (GRCm39) missense probably benign 0.00
IGL01991:Asxl3 APN 18 22,649,219 (GRCm39) missense probably damaging 1.00
IGL02064:Asxl3 APN 18 22,657,401 (GRCm39) missense possibly damaging 0.59
IGL02187:Asxl3 APN 18 22,658,035 (GRCm39) missense probably damaging 0.99
IGL02219:Asxl3 APN 18 22,586,683 (GRCm39) missense possibly damaging 0.81
IGL02309:Asxl3 APN 18 22,655,510 (GRCm39) missense probably benign 0.01
IGL02478:Asxl3 APN 18 22,656,070 (GRCm39) missense possibly damaging 0.77
IGL02506:Asxl3 APN 18 22,585,456 (GRCm39) missense probably benign 0.19
IGL02660:Asxl3 APN 18 22,657,402 (GRCm39) missense probably damaging 0.98
IGL02828:Asxl3 APN 18 22,657,718 (GRCm39) missense possibly damaging 0.87
IGL02863:Asxl3 APN 18 22,656,541 (GRCm39) missense probably benign 0.01
IGL03001:Asxl3 APN 18 22,650,455 (GRCm39) missense probably damaging 1.00
IGL03143:Asxl3 APN 18 22,656,031 (GRCm39) missense probably benign 0.43
ANU22:Asxl3 UTSW 18 22,649,503 (GRCm39) missense probably benign 0.06
BB001:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
BB011:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
R0145:Asxl3 UTSW 18 22,586,662 (GRCm39) missense probably damaging 1.00
R0201:Asxl3 UTSW 18 22,656,211 (GRCm39) missense probably benign
R0207:Asxl3 UTSW 18 22,544,553 (GRCm39) splice site probably benign
R0230:Asxl3 UTSW 18 22,585,383 (GRCm39) splice site probably benign
R0242:Asxl3 UTSW 18 22,649,738 (GRCm39) missense possibly damaging 0.94
R0242:Asxl3 UTSW 18 22,649,738 (GRCm39) missense possibly damaging 0.94
R0344:Asxl3 UTSW 18 22,650,668 (GRCm39) missense probably benign 0.00
R0519:Asxl3 UTSW 18 22,656,577 (GRCm39) missense possibly damaging 0.85
R0520:Asxl3 UTSW 18 22,656,043 (GRCm39) missense probably damaging 0.96
R0548:Asxl3 UTSW 18 22,654,849 (GRCm39) splice site probably benign
R0626:Asxl3 UTSW 18 22,655,937 (GRCm39) missense probably benign 0.02
R0711:Asxl3 UTSW 18 22,657,508 (GRCm39) missense probably benign 0.01
R0744:Asxl3 UTSW 18 22,649,097 (GRCm39) missense probably damaging 1.00
R0833:Asxl3 UTSW 18 22,649,097 (GRCm39) missense probably damaging 1.00
R1035:Asxl3 UTSW 18 22,658,106 (GRCm39) missense probably damaging 1.00
R1170:Asxl3 UTSW 18 22,657,564 (GRCm39) missense probably benign 0.00
R1372:Asxl3 UTSW 18 22,543,066 (GRCm39) missense probably benign 0.00
R1440:Asxl3 UTSW 18 22,658,281 (GRCm39) missense probably benign 0.13
R1463:Asxl3 UTSW 18 22,649,810 (GRCm39) missense possibly damaging 0.94
R1471:Asxl3 UTSW 18 22,649,411 (GRCm39) missense probably damaging 1.00
R1618:Asxl3 UTSW 18 22,650,044 (GRCm39) missense probably damaging 1.00
R1720:Asxl3 UTSW 18 22,585,492 (GRCm39) missense probably damaging 1.00
R1819:Asxl3 UTSW 18 22,655,433 (GRCm39) missense probably damaging 1.00
R1824:Asxl3 UTSW 18 22,655,125 (GRCm39) missense probably damaging 1.00
R1851:Asxl3 UTSW 18 22,650,796 (GRCm39) missense probably damaging 0.97
R1989:Asxl3 UTSW 18 22,585,420 (GRCm39) missense probably damaging 1.00
R2041:Asxl3 UTSW 18 22,656,508 (GRCm39) missense probably benign 0.02
R2174:Asxl3 UTSW 18 22,586,701 (GRCm39) missense possibly damaging 0.76
R2175:Asxl3 UTSW 18 22,649,652 (GRCm39) missense probably benign
R2443:Asxl3 UTSW 18 22,544,596 (GRCm39) missense probably benign 0.12
R2907:Asxl3 UTSW 18 22,650,330 (GRCm39) missense possibly damaging 0.56
R4246:Asxl3 UTSW 18 22,658,557 (GRCm39) missense probably damaging 1.00
R4254:Asxl3 UTSW 18 22,657,423 (GRCm39) missense possibly damaging 0.58
R4441:Asxl3 UTSW 18 22,657,290 (GRCm39) missense probably damaging 0.97
R4660:Asxl3 UTSW 18 22,649,534 (GRCm39) missense probably benign 0.00
R4661:Asxl3 UTSW 18 22,649,534 (GRCm39) missense probably benign 0.00
R4674:Asxl3 UTSW 18 22,650,795 (GRCm39) missense probably damaging 1.00
R4749:Asxl3 UTSW 18 22,649,826 (GRCm39) missense probably damaging 0.99
R4817:Asxl3 UTSW 18 22,658,511 (GRCm39) missense probably damaging 0.97
R4935:Asxl3 UTSW 18 22,656,369 (GRCm39) missense probably benign 0.06
R5062:Asxl3 UTSW 18 22,655,775 (GRCm39) missense possibly damaging 0.92
R5064:Asxl3 UTSW 18 22,649,076 (GRCm39) missense probably benign 0.00
R5065:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5066:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5067:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5133:Asxl3 UTSW 18 22,649,765 (GRCm39) missense probably damaging 1.00
R5174:Asxl3 UTSW 18 22,656,172 (GRCm39) missense probably benign 0.45
R5183:Asxl3 UTSW 18 22,658,356 (GRCm39) missense possibly damaging 0.94
R5416:Asxl3 UTSW 18 22,657,551 (GRCm39) missense probably damaging 1.00
R5587:Asxl3 UTSW 18 22,658,304 (GRCm39) missense probably benign 0.28
R5873:Asxl3 UTSW 18 22,649,142 (GRCm39) missense probably benign 0.04
R6240:Asxl3 UTSW 18 22,598,565 (GRCm39) missense probably damaging 1.00
R6242:Asxl3 UTSW 18 22,655,433 (GRCm39) missense probably damaging 1.00
R6316:Asxl3 UTSW 18 22,655,839 (GRCm39) missense probably damaging 1.00
R6348:Asxl3 UTSW 18 22,650,330 (GRCm39) missense possibly damaging 0.56
R6518:Asxl3 UTSW 18 22,649,397 (GRCm39) missense probably damaging 0.96
R6605:Asxl3 UTSW 18 22,650,134 (GRCm39) nonsense probably null
R6704:Asxl3 UTSW 18 22,650,362 (GRCm39) missense probably benign 0.00
R6706:Asxl3 UTSW 18 22,586,666 (GRCm39) missense probably damaging 1.00
R6786:Asxl3 UTSW 18 22,658,497 (GRCm39) missense probably damaging 1.00
R6799:Asxl3 UTSW 18 22,598,457 (GRCm39) nonsense probably null
R6811:Asxl3 UTSW 18 22,655,968 (GRCm39) missense possibly damaging 0.87
R6817:Asxl3 UTSW 18 22,656,637 (GRCm39) missense probably benign 0.00
R6830:Asxl3 UTSW 18 22,658,445 (GRCm39) missense probably benign 0.45
R6957:Asxl3 UTSW 18 22,655,148 (GRCm39) missense probably damaging 1.00
R7015:Asxl3 UTSW 18 22,656,978 (GRCm39) missense probably benign 0.00
R7058:Asxl3 UTSW 18 22,650,731 (GRCm39) missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22,650,759 (GRCm39) missense probably damaging 1.00
R7135:Asxl3 UTSW 18 22,650,758 (GRCm39) nonsense probably null
R7231:Asxl3 UTSW 18 22,650,597 (GRCm39) missense probably damaging 1.00
R7231:Asxl3 UTSW 18 22,544,556 (GRCm39) critical splice acceptor site probably null
R7431:Asxl3 UTSW 18 22,650,010 (GRCm39) missense probably damaging 1.00
R7851:Asxl3 UTSW 18 22,650,279 (GRCm39) missense possibly damaging 0.62
R7871:Asxl3 UTSW 18 22,657,281 (GRCm39) missense not run
R7880:Asxl3 UTSW 18 22,655,208 (GRCm39) missense possibly damaging 0.90
R7924:Asxl3 UTSW 18 22,658,602 (GRCm39) missense probably damaging 0.98
R8061:Asxl3 UTSW 18 22,657,300 (GRCm39) missense possibly damaging 0.62
R8115:Asxl3 UTSW 18 22,650,642 (GRCm39) missense probably damaging 0.99
R8174:Asxl3 UTSW 18 22,650,800 (GRCm39) missense probably benign 0.02
R8303:Asxl3 UTSW 18 22,657,473 (GRCm39) missense probably benign
R8360:Asxl3 UTSW 18 22,649,174 (GRCm39) missense probably benign
R8547:Asxl3 UTSW 18 22,655,829 (GRCm39) missense probably benign 0.04
R8699:Asxl3 UTSW 18 22,567,664 (GRCm39) missense probably benign 0.02
R8774:Asxl3 UTSW 18 22,657,101 (GRCm39) missense probably damaging 0.99
R8774-TAIL:Asxl3 UTSW 18 22,657,101 (GRCm39) missense probably damaging 0.99
R8867:Asxl3 UTSW 18 22,649,547 (GRCm39) missense possibly damaging 0.87
R8915:Asxl3 UTSW 18 22,657,763 (GRCm39) missense probably benign 0.00
R8954:Asxl3 UTSW 18 22,650,807 (GRCm39) missense probably damaging 1.00
R9031:Asxl3 UTSW 18 22,657,401 (GRCm39) missense probably damaging 0.96
R9047:Asxl3 UTSW 18 22,585,471 (GRCm39) missense probably damaging 1.00
R9047:Asxl3 UTSW 18 22,585,465 (GRCm39) missense probably damaging 1.00
R9135:Asxl3 UTSW 18 22,657,481 (GRCm39) missense possibly damaging 0.89
R9135:Asxl3 UTSW 18 22,649,670 (GRCm39) missense probably damaging 0.99
R9210:Asxl3 UTSW 18 22,655,389 (GRCm39) missense probably benign 0.15
R9212:Asxl3 UTSW 18 22,655,389 (GRCm39) missense probably benign 0.15
R9285:Asxl3 UTSW 18 22,654,989 (GRCm39) missense probably damaging 1.00
R9572:Asxl3 UTSW 18 22,649,112 (GRCm39) missense probably benign 0.25
R9707:Asxl3 UTSW 18 22,656,304 (GRCm39) missense probably benign 0.01
R9768:Asxl3 UTSW 18 22,650,101 (GRCm39) missense probably benign 0.00
R9784:Asxl3 UTSW 18 22,650,311 (GRCm39) missense probably benign
Z1088:Asxl3 UTSW 18 22,649,829 (GRCm39) missense probably benign 0.00
Z1176:Asxl3 UTSW 18 22,655,277 (GRCm39) missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22,656,648 (GRCm39) missense probably damaging 1.00
Z1177:Asxl3 UTSW 18 22,649,396 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGGAGTCGGAAAGTCC -3'
(R):5'- CTCAGAGATGCAAGCGTTTTCTG -3'

Sequencing Primer
(F):5'- CTTGTGAGGAACCCCAGGTAG -3'
(R):5'- AGATGCAAGCGTTTTCTGAGAGC -3'
Posted On 2016-07-22