Incidental Mutation 'R5294:Diaph1'
ID405336
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Namediaphanous related formin 1
SynonymsDrf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37843601-37935476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37897580 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 274 (M274V)
Ref Sequence ENSEMBL: ENSMUSP00000111297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
PDB Structure
Crystal structure of the core FH2 domain of mouse mDia1 [X-RAY DIFFRACTION]
Crystal structure of mDIA1 GBD-FH3 in complex with RhoC-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of the N-terminal mDia1 Armadillo Repeat Region and Dimerisation Domain in complex with the mDia1 autoregulatory domain (DAD) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE DIMERIC REGULATORY DOMAIN OF MOUSE DIAPHANEOUS-RELATED FORMIN (DRF), MDIA1 [X-RAY DIFFRACTION]
Crystal structure of the autoinhibitory switch in Formin mDia1; the DID/DAD complex [X-RAY DIFFRACTION]
Mouse Profilin IIa in complex with a double repeat from the FH1 domain of mDia1 [X-RAY DIFFRACTION]
Crystal structure of MDIA1-TSH GBD-FH3 in complex with CDC42-GMPPNP [X-RAY DIFFRACTION]
Crystal structure of complex between amino and carboxy terminal fragments of mDia1 [X-RAY DIFFRACTION]
Autoinhibited Formin mDia1 Structure [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000025337
AA Change: M283V
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456
AA Change: M283V

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000080033
AA Change: M274V
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456
AA Change: M274V

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115629
AA Change: M239V
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456
AA Change: M239V

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115631
AA Change: M239V
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456
AA Change: M239V

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115634
AA Change: M274V
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456
AA Change: M274V

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129688
Meta Mutation Damage Score 0.6984 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
fishnets UTSW 18 37895300 critical splice acceptor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7073:Diaph1 UTSW 18 37889814 critical splice acceptor site probably null
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
R7497:Diaph1 UTSW 18 37895300 critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 37893269 intron probably null
R7703:Diaph1 UTSW 18 37890809 missense unknown
R7834:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
R8073:Diaph1 UTSW 18 37891797 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCCATACCACAGAGAAATGAAGG -3'
(R):5'- CCGCATGTCATGTGCATTGG -3'

Sequencing Primer
(F):5'- GACAGGTGAACTCTGGGCTTTC -3'
(R):5'- TCAGATGGTCCTTAAAAAGTCAGAG -3'
Posted On2016-07-22