Mutagenetix > Incidental Mutation

Incidental Mutation 'R5294:Dock8'

405340

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

042877-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5294 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25061153 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 68 (V68M)

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025831
AA Change: V68M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: V68M

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	T	C	9: 89,152,003		noncoding transcript	Het
Acaca	A	G	11: 84,391,519	E2154G	probably benign	Het
Acacb	T	C	5: 114,241,952	F2056L	probably damaging	Het
Aff1	A	G	5: 103,811,157		probably benign	Het
Amn1	T	A	6: 149,185,124		probably benign	Het
Arid1a	C	A	4: 133,691,055		probably benign	Het
Aste1	T	A	9: 105,402,705		probably null	Het
Asxl3	T	A	18: 22,516,439	V495D	possibly damaging	Het
Atp1a3	T	A	7: 24,988,048	H688L	probably damaging	Het
B3gnt8	T	C	7: 25,628,766	L207P	probably damaging	Het
Baz2b	T	C	2: 59,978,602	H101R	probably benign	Het
Bicc1	G	A	10: 70,947,900	T387M	possibly damaging	Het
Champ1	A	C	8: 13,878,981	K380Q	probably damaging	Het
Cnst	A	G	1: 179,610,440	E523G	probably benign	Het
Cops6	G	C	5: 138,161,116		probably benign	Het
Cp	G	C	3: 19,966,316	V158L	probably benign	Het
Cyfip1	T	A	7: 55,873,483	M52K	possibly damaging	Het
Dars	A	T	1: 128,364,302	F480I	probably benign	Het
Diaph1	T	C	18: 37,897,580	M274V	unknown	Het
Diaph1	C	A	18: 37,897,550	E284*	probably null	Het
Elavl4	A	G	4: 110,211,430	F247L	possibly damaging	Het
Emc10	C	T	7: 44,496,439		probably benign	Het
Fbxw16	T	C	9: 109,436,644	D369G	probably benign	Het
Fgr	A	T	4: 132,997,500	D304V	probably benign	Het
Filip1l	G	A	16: 57,570,036	S91N	possibly damaging	Het
Gm884	A	G	11: 103,616,231		probably benign	Het
Haus8	A	G	8: 71,255,710	S103P	unknown	Het
Hscb	A	G	5: 110,834,792	L143P	probably damaging	Het
Hsd11b2	A	T	8: 105,523,297	M347L	probably benign	Het
Jrk	C	A	15: 74,707,336	E33D	possibly damaging	Het
Kbtbd8	T	A	6: 95,121,832	Y123*	probably null	Het
Mis18bp1	A	C	12: 65,157,043	M59R	probably damaging	Het
Mrps27	T	C	13: 99,409,873	V260A	probably damaging	Het
Ncapg2	G	T	12: 116,427,794	V488L	possibly damaging	Het
Nepn	A	T	10: 52,400,800	N211Y	probably benign	Het
Ntrk3	A	T	7: 78,517,506		probably null	Het
Olfr248	A	T	1: 174,391,225	Y52F	probably benign	Het
Olfr692	C	T	7: 105,368,413	T20I	probably benign	Het
Olfr748	A	G	14: 50,710,779	I150V	probably benign	Het
Olfr748	A	G	14: 50,710,443	T38A	possibly damaging	Het
Otud4	A	T	8: 79,672,892	Q744L	possibly damaging	Het
P2ry14	A	T	3: 59,115,568	I166N	possibly damaging	Het
Pak2	T	A	16: 32,021,830	N478Y	probably damaging	Het
Papss2	A	G	19: 32,639,000	D202G	probably benign	Het
Pcdh7	C	A	5: 57,728,111		probably null	Het
Peg3	C	A	7: 6,717,849	S19I	possibly damaging	Het
Prim2	G	T	1: 33,668,893	T40K	probably benign	Het
Ranbp2	T	C	10: 58,478,668	F1737L	probably benign	Het
Rex2	A	C	4: 147,057,985	N310T	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf39	C	T	17: 36,947,200	A86V	probably damaging	Het
Ror1	A	T	4: 100,425,938	N400I	probably benign	Het
Slc38a8	C	T	8: 119,494,289	G177D	probably damaging	Het
Slc43a3	T	C	2: 84,956,310	V445A	probably benign	Het
Sptbn2	A	G	19: 4,718,908	N23S	possibly damaging	Het
Taf5l	A	G	8: 124,008,218	F74L	probably benign	Het
Trappc11	G	C	8: 47,530,731	A42G	possibly damaging	Het
Trim30d	T	C	7: 104,472,488	K350R	probably damaging	Het
Trnt1	T	C	6: 106,773,414	F93S	probably damaging	Het
Ube2c	T	C	2: 164,777,190	V161A	probably benign	Het
Usp24	A	G	4: 106,362,357	E555G	possibly damaging	Het
Vmn2r55	T	G	7: 12,651,864	S730R	probably damaging	Het
Vmn2r89	T	A	14: 51,455,113	N124K	probably benign	Het
Vmn2r98	T	A	17: 19,069,754	C517*	probably null	Het
Vps13a	A	T	19: 16,641,667	I2845N	probably damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Xpo5	T	C	17: 46,236,922	V896A	probably benign	Het
Zfp2	T	C	11: 50,901,241		probably benign	Het
Zgrf1	G	A	3: 127,600,980	M1328I	probably benign	Het
Zswim5	A	G	4: 116,979,577	D686G	possibly damaging	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127712	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0147:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6885:Dock8	UTSW	19	25147378	missense	possibly damaging	0.95
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7203:Dock8	UTSW	19	25181563	missense	probably damaging	1.00
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7296:Dock8	UTSW	19	25184881	missense	probably benign	0.00
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7641:Dock8	UTSW	19	25174333	critical splice donor site	probably null
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
R9292:Dock8	UTSW	19	25183631	splice site	probably benign
R9509:Dock8	UTSW	19	25095621	missense	probably benign	0.00
R9526:Dock8	UTSW	19	25188375	missense	probably benign	0.10
R9622:Dock8	UTSW	19	25121181	missense	probably null
R9634:Dock8	UTSW	19	25192221	missense	probably damaging	1.00
R9654:Dock8	UTSW	19	25147346	missense	probably damaging	1.00
R9670:Dock8	UTSW	19	25171562	missense	probably null	0.01
R9699:Dock8	UTSW	19	25156024	critical splice donor site	probably null
R9726:Dock8	UTSW	19	25177010	missense	probably damaging	0.97
R9765:Dock8	UTSW	19	25169468	missense	possibly damaging	0.94
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- CTGTCACAATTGCAGTTTGACAG -3'
(R):5'- GGTTCAGAATCAGCACCCTTCC -3'

Sequencing Primer
(F):5'- CCAGTCGCTTCATTTAGGCTAAAAG -3'
(R):5'- GAATCAGCACCCTTCCCATCTC -3'

Posted On

2016-07-22