Incidental Mutation 'R5294:Dock8'
ID405340
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Namededicator of cytokinesis 8
SynonymsA130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location24999529-25202432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25061153 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 68 (V68M)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025831
AA Change: V68M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: V68M

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Papss2 A G 19: 32,639,000 D202G probably benign Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTGTCACAATTGCAGTTTGACAG -3'
(R):5'- GGTTCAGAATCAGCACCCTTCC -3'

Sequencing Primer
(F):5'- CCAGTCGCTTCATTTAGGCTAAAAG -3'
(R):5'- GAATCAGCACCCTTCCCATCTC -3'
Posted On2016-07-22