Incidental Mutation 'R5294:Papss2'
ID405341
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission 042877-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5294 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32639000 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 202 (D202G)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect probably benign
Transcript: ENSMUST00000025833
AA Change: D202G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: D202G

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Meta Mutation Damage Score 0.1411 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,152,003 noncoding transcript Het
Acaca A G 11: 84,391,519 E2154G probably benign Het
Acacb T C 5: 114,241,952 F2056L probably damaging Het
Aff1 A G 5: 103,811,157 probably benign Het
Amn1 T A 6: 149,185,124 probably benign Het
Arid1a C A 4: 133,691,055 probably benign Het
Aste1 T A 9: 105,402,705 probably null Het
Asxl3 T A 18: 22,516,439 V495D possibly damaging Het
Atp1a3 T A 7: 24,988,048 H688L probably damaging Het
B3gnt8 T C 7: 25,628,766 L207P probably damaging Het
Baz2b T C 2: 59,978,602 H101R probably benign Het
Bicc1 G A 10: 70,947,900 T387M possibly damaging Het
Champ1 A C 8: 13,878,981 K380Q probably damaging Het
Cnst A G 1: 179,610,440 E523G probably benign Het
Cops6 G C 5: 138,161,116 probably benign Het
Cp G C 3: 19,966,316 V158L probably benign Het
Cyfip1 T A 7: 55,873,483 M52K possibly damaging Het
Dars A T 1: 128,364,302 F480I probably benign Het
Diaph1 C A 18: 37,897,550 E284* probably null Het
Diaph1 T C 18: 37,897,580 M274V unknown Het
Dock8 G A 19: 25,061,153 V68M probably benign Het
Elavl4 A G 4: 110,211,430 F247L possibly damaging Het
Emc10 C T 7: 44,496,439 probably benign Het
Fbxw16 T C 9: 109,436,644 D369G probably benign Het
Fgr A T 4: 132,997,500 D304V probably benign Het
Filip1l G A 16: 57,570,036 S91N possibly damaging Het
Gm884 A G 11: 103,616,231 probably benign Het
Haus8 A G 8: 71,255,710 S103P unknown Het
Hscb A G 5: 110,834,792 L143P probably damaging Het
Hsd11b2 A T 8: 105,523,297 M347L probably benign Het
Jrk C A 15: 74,707,336 E33D possibly damaging Het
Kbtbd8 T A 6: 95,121,832 Y123* probably null Het
Mis18bp1 A C 12: 65,157,043 M59R probably damaging Het
Mrps27 T C 13: 99,409,873 V260A probably damaging Het
Ncapg2 G T 12: 116,427,794 V488L possibly damaging Het
Nepn A T 10: 52,400,800 N211Y probably benign Het
Ntrk3 A T 7: 78,517,506 probably null Het
Olfr248 A T 1: 174,391,225 Y52F probably benign Het
Olfr692 C T 7: 105,368,413 T20I probably benign Het
Olfr748 A G 14: 50,710,443 T38A possibly damaging Het
Olfr748 A G 14: 50,710,779 I150V probably benign Het
Otud4 A T 8: 79,672,892 Q744L possibly damaging Het
P2ry14 A T 3: 59,115,568 I166N possibly damaging Het
Pak2 T A 16: 32,021,830 N478Y probably damaging Het
Pcdh7 C A 5: 57,728,111 probably null Het
Peg3 C A 7: 6,717,849 S19I possibly damaging Het
Prim2 G T 1: 33,668,893 T40K probably benign Het
Ranbp2 T C 10: 58,478,668 F1737L probably benign Het
Rex2 A C 4: 147,057,985 N310T probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf39 C T 17: 36,947,200 A86V probably damaging Het
Ror1 A T 4: 100,425,938 N400I probably benign Het
Slc38a8 C T 8: 119,494,289 G177D probably damaging Het
Slc43a3 T C 2: 84,956,310 V445A probably benign Het
Sptbn2 A G 19: 4,718,908 N23S possibly damaging Het
Taf5l A G 8: 124,008,218 F74L probably benign Het
Trappc11 G C 8: 47,530,731 A42G possibly damaging Het
Trim30d T C 7: 104,472,488 K350R probably damaging Het
Trnt1 T C 6: 106,773,414 F93S probably damaging Het
Ube2c T C 2: 164,777,190 V161A probably benign Het
Usp24 A G 4: 106,362,357 E555G possibly damaging Het
Vmn2r55 T G 7: 12,651,864 S730R probably damaging Het
Vmn2r89 T A 14: 51,455,113 N124K probably benign Het
Vmn2r98 T A 17: 19,069,754 C517* probably null Het
Vps13a A T 19: 16,641,667 I2845N probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Xpo5 T C 17: 46,236,922 V896A probably benign Het
Zfp2 T C 11: 50,901,241 probably benign Het
Zgrf1 G A 3: 127,600,980 M1328I probably benign Het
Zswim5 A G 4: 116,979,577 D686G possibly damaging Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 synonymous probably null
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGAGTCAAGGATGGACTGTTC -3'
(R):5'- TAGTTACTGAGATTGGCCAGGG -3'

Sequencing Primer
(F):5'- TCAAGGATGGACTGTTCAAAGTC -3'
(R):5'- TTGGCCAGGGAATAAAGAAACTC -3'
Posted On2016-07-22