Incidental Mutation 'R5295:Atp5f1c'
ID 405342
Institutional Source Beutler Lab
Gene Symbol Atp5f1c
Ensembl Gene ENSMUSG00000025781
Gene Name ATP synthase F1 subunit gamma
Synonyms Atp5c1, 1700094F02Rik, F1 gamma
MMRRC Submission 042878-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R5295 (G1)
Quality Score 189
Status Not validated
Chromosome 2
Chromosomal Location 10060841-10085321 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10073544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 10 (R10G)
Ref Sequence ENSEMBL: ENSMUSP00000116368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026887] [ENSMUST00000114896] [ENSMUST00000114897] [ENSMUST00000130067] [ENSMUST00000139810] [ENSMUST00000145530] [ENSMUST00000153554]
AlphaFold Q91VR2
Predicted Effect probably benign
Transcript: ENSMUST00000026887
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026887
Gene: ENSMUSG00000025781
AA Change: R34G

DomainStartEndE-ValueType
Pfam:ATP-synt 26 297 1.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114896
AA Change: R10G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110546
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 273 1.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114897
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110547
Gene: ENSMUSG00000025781
AA Change: R34G

DomainStartEndE-ValueType
Pfam:ATP-synt 27 297 6.8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130067
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117182
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 101 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139810
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123100
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 153 6.1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145530
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116508
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 187 1.2e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153554
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116368
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 171 1.2e-43 PFAM
Meta Mutation Damage Score 0.9369 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,438,109 (GRCm39) E1095K probably damaging Het
Alpl T C 4: 137,476,919 (GRCm39) T245A probably benign Het
Ank2 T C 3: 126,825,832 (GRCm39) H378R probably damaging Het
Arhgef1 G A 7: 24,618,777 (GRCm39) probably null Het
Cbln3 T C 14: 56,120,920 (GRCm39) probably null Het
Ccr10 C T 11: 101,065,111 (GRCm39) V140M possibly damaging Het
Cep135 T A 5: 76,741,051 (GRCm39) H42Q possibly damaging Het
Commd5 C A 15: 76,785,152 (GRCm39) T183K possibly damaging Het
Dnajc16 T C 4: 141,495,239 (GRCm39) E493G possibly damaging Het
Ears2 T C 7: 121,647,421 (GRCm39) R288G probably damaging Het
Elovl4 G A 9: 83,662,714 (GRCm39) P273L possibly damaging Het
Fam186b T A 15: 99,181,755 (GRCm39) I148F probably damaging Het
Fryl T C 5: 73,270,134 (GRCm39) Y79C probably damaging Het
Gad1-ps A G 10: 99,280,751 (GRCm39) noncoding transcript Het
Gm14325 G A 2: 177,474,777 (GRCm39) H102Y possibly damaging Het
Ighv1-77 T A 12: 115,825,528 (GRCm39) S104C probably damaging Het
Kcnv1 T C 15: 44,977,987 (GRCm39) D17G unknown Het
Lmtk3 G A 7: 45,440,722 (GRCm39) D243N probably damaging Het
Lrrc7 T A 3: 157,876,376 (GRCm39) K571N probably damaging Het
Lsm7 T C 10: 80,690,454 (GRCm39) E32G probably damaging Het
Ly6f A G 15: 75,143,488 (GRCm39) Q65R probably benign Het
Perm1 T C 4: 156,301,975 (GRCm39) L173P probably benign Het
Plvap T C 8: 71,964,314 (GRCm39) Q16R probably benign Het
Prb1c T G 6: 132,338,840 (GRCm39) Q126P unknown Het
Prl7d1 A T 13: 27,893,230 (GRCm39) V227D probably damaging Het
Prss54 T C 8: 96,291,106 (GRCm39) T165A probably damaging Het
Psrc1 A G 3: 108,293,675 (GRCm39) I195V probably benign Het
Rnf123 AT ATT 9: 107,941,202 (GRCm39) probably null Het
Rnf213 A T 11: 119,331,642 (GRCm39) T2284S probably benign Het
Serpina3c T C 12: 104,114,637 (GRCm39) E333G probably damaging Het
Serpinb6c A G 13: 34,077,800 (GRCm39) F190S probably damaging Het
Sfmbt1 G A 14: 30,495,986 (GRCm39) D90N probably damaging Het
Tdh T C 14: 63,733,558 (GRCm39) Y110C probably damaging Het
Tdrd9 T A 12: 112,018,346 (GRCm39) L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,707,084 (GRCm39) probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Zbtb2 T C 10: 4,318,508 (GRCm39) K506R probably damaging Het
Zmiz1 T C 14: 25,656,771 (GRCm39) L800P probably damaging Het
Znhit6 A G 3: 145,306,248 (GRCm39) D251G probably benign Het
Other mutations in Atp5f1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Atp5f1c APN 2 10,073,477 (GRCm39) missense probably damaging 1.00
R3106:Atp5f1c UTSW 2 10,068,276 (GRCm39) missense probably benign 0.35
R4651:Atp5f1c UTSW 2 10,068,287 (GRCm39) missense probably damaging 1.00
R4670:Atp5f1c UTSW 2 10,064,428 (GRCm39) missense probably damaging 1.00
R5097:Atp5f1c UTSW 2 10,068,323 (GRCm39) missense probably benign 0.01
R5275:Atp5f1c UTSW 2 10,073,544 (GRCm39) missense possibly damaging 0.51
R6195:Atp5f1c UTSW 2 10,068,926 (GRCm39) missense possibly damaging 0.79
R6536:Atp5f1c UTSW 2 10,085,127 (GRCm39) unclassified probably benign
R9050:Atp5f1c UTSW 2 10,069,049 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGTCGTCTCTGCCCG -3'
(R):5'- TCATGCCATGTCCTAAGTAGCA -3'

Sequencing Primer
(F):5'- CATACTTTGCAGCTGCC -3'
(R):5'- GCCATGTCCTAAGTAGCAAGTCTTG -3'
Posted On 2016-07-22