Mutagenetix > Incidental Mutation

Incidental Mutation 'R5295:Atp5c1'

405342

Institutional Source

Beutler Lab

Gene Symbol

Atp5c1

Ensembl Gene

ENSMUSG00000025781

Gene Name

ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1

Synonyms

F1 gamma, 1700094F02Rik

MMRRC Submission

042878-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R5295 (G1)

Quality Score

189

Status

Not validated

Chromosome

Chromosomal Location

10056016-10080510 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10068733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 10 (R10G)

Ref Sequence

ENSEMBL: ENSMUSP00000116368 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026887] [ENSMUST00000114896] [ENSMUST00000114897] [ENSMUST00000130067] [ENSMUST00000139810] [ENSMUST00000145530] [ENSMUST00000153554]

AlphaFold

Q91VR2

Predicted Effect

probably benign
Transcript: ENSMUST00000026887
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026887
Gene: ENSMUSG00000025781
AA Change: R34G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	26	297	1.7e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114896
AA Change: R10G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110546
Gene: ENSMUSG00000025781
AA Change: R10G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	2	273	1.2e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114897
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000110547
Gene: ENSMUSG00000025781
AA Change: R34G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	27	297	6.8e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130067
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117182
Gene: ENSMUSG00000025781
AA Change: R10G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	2	101	2.1e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139810
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000123100
Gene: ENSMUSG00000025781
AA Change: R10G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	2	153	6.1e-39	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145530
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116508
Gene: ENSMUSG00000025781
AA Change: R10G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	2	187	1.2e-45	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153554
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116368
Gene: ENSMUSG00000025781
AA Change: R10G

Domain	Start	End	E-Value	Type
Pfam:ATP-synt	2	171	1.2e-43	PFAM

Meta Mutation Damage Score

0.9369

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	T	18: 65,305,038	E1095K	probably damaging	Het
Alpl	T	C	4: 137,749,608	T245A	probably benign	Het
Ank2	T	C	3: 127,032,183	H378R	probably damaging	Het
Arhgef1	G	A	7: 24,919,352		probably null	Het
Cbln3	T	C	14: 55,883,463		probably null	Het
Ccr10	C	T	11: 101,174,285	V140M	possibly damaging	Het
Cep135	T	A	5: 76,593,204	H42Q	possibly damaging	Het
Commd5	C	A	15: 76,900,952	T183K	possibly damaging	Het
Dnajc16	T	C	4: 141,767,928	E493G	possibly damaging	Het
Ears2	T	C	7: 122,048,198	R288G	probably damaging	Het
Elovl4	G	A	9: 83,780,661	P273L	possibly damaging	Het
Fam186b	T	A	15: 99,283,874	I148F	probably damaging	Het
Fryl	T	C	5: 73,112,791	Y79C	probably damaging	Het
Gad1-ps	A	G	10: 99,444,889		noncoding transcript	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm8882	T	G	6: 132,361,877	Q126P	unknown	Het
Ighv1-77	T	A	12: 115,861,908	S104C	probably damaging	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Lmtk3	G	A	7: 45,791,298	D243N	probably damaging	Het
Lrrc7	T	A	3: 158,170,739	K571N	probably damaging	Het
Lsm7	T	C	10: 80,854,620	E32G	probably damaging	Het
Ly6f	A	G	15: 75,271,639	Q65R	probably benign	Het
Perm1	T	C	4: 156,217,518	L173P	probably benign	Het
Plvap	T	C	8: 71,511,670	Q16R	probably benign	Het
Prl7d1	A	T	13: 27,709,247	V227D	probably damaging	Het
Prss54	T	C	8: 95,564,478	T165A	probably damaging	Het
Psrc1	A	G	3: 108,386,359	I195V	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf213	A	T	11: 119,440,816	T2284S	probably benign	Het
Serpina3c	T	C	12: 104,148,378	E333G	probably damaging	Het
Serpinb6c	A	G	13: 33,893,817	F190S	probably damaging	Het
Sfmbt1	G	A	14: 30,774,029	D90N	probably damaging	Het
Tdh	T	C	14: 63,496,109	Y110C	probably damaging	Het
Tdrd9	T	A	12: 112,051,912	L1255*	probably null	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zbtb2	T	C	10: 4,368,508	K506R	probably damaging	Het
Zmiz1	T	C	14: 25,656,347	L800P	probably damaging	Het
Znhit6	A	G	3: 145,600,493	D251G	probably benign	Het

Other mutations in Atp5c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01538:Atp5c1	APN	2	10068666	missense	probably damaging	1.00
R3106:Atp5c1	UTSW	2	10063465	missense	probably benign	0.35
R4651:Atp5c1	UTSW	2	10063476	missense	probably damaging	1.00
R4670:Atp5c1	UTSW	2	10059617	missense	probably damaging	1.00
R5097:Atp5c1	UTSW	2	10063512	missense	probably benign	0.01
R5275:Atp5c1	UTSW	2	10068733	missense	possibly damaging	0.51
R6195:Atp5c1	UTSW	2	10064115	missense	possibly damaging	0.79
R6536:Atp5c1	UTSW	2	10080316	unclassified	probably benign
R9050:Atp5c1	UTSW	2	10064238	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGTCGTCTCTGCCCG -3'
(R):5'- TCATGCCATGTCCTAAGTAGCA -3'

Sequencing Primer
(F):5'- CATACTTTGCAGCTGCC -3'
(R):5'- GCCATGTCCTAAGTAGCAAGTCTTG -3'

Posted On

2016-07-22