Incidental Mutation 'R5295:Atp5c1'
ID405342
Institutional Source Beutler Lab
Gene Symbol Atp5c1
Ensembl Gene ENSMUSG00000025781
Gene NameATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
SynonymsF1 gamma, 1700094F02Rik
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5295 (G1)
Quality Score189
Status Not validated
Chromosome2
Chromosomal Location10056016-10080510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10068733 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 10 (R10G)
Ref Sequence ENSEMBL: ENSMUSP00000116368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026887] [ENSMUST00000114896] [ENSMUST00000114897] [ENSMUST00000130067] [ENSMUST00000139810] [ENSMUST00000145530] [ENSMUST00000153554]
Predicted Effect probably benign
Transcript: ENSMUST00000026887
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026887
Gene: ENSMUSG00000025781
AA Change: R34G

DomainStartEndE-ValueType
Pfam:ATP-synt 26 297 1.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114896
AA Change: R10G

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110546
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 273 1.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114897
AA Change: R34G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110547
Gene: ENSMUSG00000025781
AA Change: R34G

DomainStartEndE-ValueType
Pfam:ATP-synt 27 297 6.8e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130067
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117182
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 101 2.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139810
AA Change: R10G

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123100
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 153 6.1e-39 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145530
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116508
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 187 1.2e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153554
AA Change: R10G

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116368
Gene: ENSMUSG00000025781
AA Change: R10G

DomainStartEndE-ValueType
Pfam:ATP-synt 2 171 1.2e-43 PFAM
Meta Mutation Damage Score 0.9369 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Atp5c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Atp5c1 APN 2 10068666 missense probably damaging 1.00
R3106:Atp5c1 UTSW 2 10063465 missense probably benign 0.35
R4651:Atp5c1 UTSW 2 10063476 missense probably damaging 1.00
R4670:Atp5c1 UTSW 2 10059617 missense probably damaging 1.00
R5097:Atp5c1 UTSW 2 10063512 missense probably benign 0.01
R5275:Atp5c1 UTSW 2 10068733 missense possibly damaging 0.51
R6195:Atp5c1 UTSW 2 10064115 missense possibly damaging 0.79
R6536:Atp5c1 UTSW 2 10080316 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTCGTCTCTGCCCG -3'
(R):5'- TCATGCCATGTCCTAAGTAGCA -3'

Sequencing Primer
(F):5'- CATACTTTGCAGCTGCC -3'
(R):5'- GCCATGTCCTAAGTAGCAAGTCTTG -3'
Posted On2016-07-22