Incidental Mutation 'R5295:Gm14325'
ID405344
Institutional Source Beutler Lab
Gene Symbol Gm14325
Ensembl Gene ENSMUSG00000095362
Gene Namepredicted gene 14325
Synonyms
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5295 (G1)
Quality Score133
Status Not validated
Chromosome2
Chromosomal Location177831791-177840336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 177832984 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 102 (H102Y)
Ref Sequence ENSEMBL: ENSMUSP00000104567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108939] [ENSMUST00000150650] [ENSMUST00000188914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108939
AA Change: H102Y

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104567
Gene: ENSMUSG00000095362
AA Change: H102Y

DomainStartEndE-ValueType
KRAB 4 64 3.43e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 3.34e-2 SMART
ZnF_C2H2 159 181 5.29e-5 SMART
ZnF_C2H2 187 209 6.08e-5 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 8.02e-5 SMART
ZnF_C2H2 271 293 3.83e-2 SMART
ZnF_C2H2 299 321 5.14e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 5.99e-4 SMART
ZnF_C2H2 383 405 1.69e-3 SMART
ZnF_C2H2 411 433 7.37e-4 SMART
ZnF_C2H2 439 461 4.94e-5 SMART
ZnF_C2H2 467 489 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150650
SMART Domains Protein: ENSMUSP00000118192
Gene: ENSMUSG00000095362

DomainStartEndE-ValueType
KRAB 4 64 3.43e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188914
AA Change: H101Y

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140685
Gene: ENSMUSG00000095362
AA Change: H101Y

DomainStartEndE-ValueType
KRAB 3 63 1.4e-15 SMART
ZnF_C2H2 77 96 6.8e-1 SMART
ZnF_C2H2 102 124 1.8e-5 SMART
ZnF_C2H2 130 152 1.4e-4 SMART
ZnF_C2H2 158 180 2.3e-7 SMART
ZnF_C2H2 186 208 2.5e-7 SMART
ZnF_C2H2 214 236 2.5e-6 SMART
ZnF_C2H2 242 264 3.3e-7 SMART
ZnF_C2H2 270 292 1.6e-4 SMART
ZnF_C2H2 298 320 2.1e-5 SMART
ZnF_C2H2 326 348 2.1e-5 SMART
ZnF_C2H2 354 376 2.5e-6 SMART
ZnF_C2H2 382 404 7.3e-6 SMART
ZnF_C2H2 410 432 3.1e-6 SMART
ZnF_C2H2 438 460 2e-7 SMART
ZnF_C2H2 466 488 4.6e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Gm14325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Gm14325 APN 2 177834652 unclassified probably benign
IGL02731:Gm14325 APN 2 177832986 missense probably damaging 1.00
IGL02988:Gm14325 APN 2 177834249 critical splice donor site probably null
R4490:Gm14325 UTSW 2 177832983 missense possibly damaging 0.95
R5274:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5277:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5394:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5395:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R6147:Gm14325 UTSW 2 177832807 missense probably damaging 1.00
R6855:Gm14325 UTSW 2 177832842 missense probably damaging 1.00
R7198:Gm14325 UTSW 2 177832005 missense probably benign 0.02
R7221:Gm14325 UTSW 2 177834610 missense probably damaging 1.00
R8206:Gm14325 UTSW 2 177832974 missense probably damaging 1.00
R8310:Gm14325 UTSW 2 177831799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACATTGGTTACATTCATACTGTT -3'
(R):5'- GCAAACACTGGGAGTTCTTCCT -3'

Sequencing Primer
(F):5'- TTCTCTCCTGCATGTGTTCGATTATG -3'
(R):5'- GAGCCACATAATCAGTACTGTTTCC -3'
Posted On2016-07-22