Incidental Mutation 'R5295:Psrc1'
ID405346
Institutional Source Beutler Lab
Gene Symbol Psrc1
Ensembl Gene ENSMUSG00000068744
Gene Nameproline/serine-rich coiled-coil 1
SynonymsDDA3, 5430413I02Rik
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108383839-108388231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108386359 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 195 (I195V)
Ref Sequence ENSEMBL: ENSMUSP00000099689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558] [ENSMUST00000090561] [ENSMUST00000102629] [ENSMUST00000128089]
Predicted Effect probably benign
Transcript: ENSMUST00000090558
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090561
AA Change: I195V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000088049
Gene: ENSMUSG00000068744
AA Change: I195V

DomainStartEndE-ValueType
Pfam:GTSE1_N 7 124 4.8e-24 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102629
AA Change: I195V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000099689
Gene: ENSMUSG00000068744
AA Change: I195V

DomainStartEndE-ValueType
Pfam:GTSE1_N 8 108 2e-12 PFAM
low complexity region 131 143 N/A INTRINSIC
low complexity region 222 231 N/A INTRINSIC
low complexity region 300 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126461
Predicted Effect probably benign
Transcript: ENSMUST00000128089
SMART Domains Protein: ENSMUSP00000115634
Gene: ENSMUSG00000068744

DomainStartEndE-ValueType
Pfam:GTSE1_N 22 139 6.5e-25 PFAM
low complexity region 146 158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145141
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148509
SMART Domains Protein: ENSMUSP00000120482
Gene: ENSMUSG00000068744

DomainStartEndE-ValueType
Pfam:GTSE1_N 5 106 3.9e-18 PFAM
low complexity region 113 125 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196430
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich protein that is a target for regulation by the tumor suppressor protein p53. The encoded protein plays an important role in mitosis by recruiting and regulating microtubule depolymerases that destabalize microtubules. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Psrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Psrc1 APN 3 108386692 missense possibly damaging 0.93
R1481:Psrc1 UTSW 3 108384993 missense probably benign 0.09
R1637:Psrc1 UTSW 3 108385293 missense probably damaging 1.00
R1645:Psrc1 UTSW 3 108385238 missense probably damaging 1.00
R5000:Psrc1 UTSW 3 108380523 unclassified probably benign
R5275:Psrc1 UTSW 3 108386359 missense probably benign 0.01
R6810:Psrc1 UTSW 3 108385348 missense possibly damaging 0.87
R7545:Psrc1 UTSW 3 108386443 intron probably null
R7909:Psrc1 UTSW 3 108385251 missense probably damaging 1.00
R7990:Psrc1 UTSW 3 108385251 missense probably damaging 1.00
R8237:Psrc1 UTSW 3 108386614 missense probably damaging 1.00
R8312:Psrc1 UTSW 3 108386357 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCTAGACAACGCCCTACC -3'
(R):5'- TGGAAGACTTGACAGCTGCTC -3'

Sequencing Primer
(F):5'- TTCTAGACAACGCCCTACCTACTATC -3'
(R):5'- ATGAACATTGGGAGTTGCTAGC -3'
Posted On2016-07-22