Incidental Mutation 'R5295:Znhit6'
ID405348
Institutional Source Beutler Lab
Gene Symbol Znhit6
Ensembl Gene ENSMUSG00000074182
Gene Namezinc finger, HIT type 6
Synonyms2410019A14Rik
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145576205-145604795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145600493 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 251 (D251G)
Ref Sequence ENSEMBL: ENSMUSP00000143306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098534] [ENSMUST00000199033]
Predicted Effect probably benign
Transcript: ENSMUST00000098534
AA Change: D419G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096136
Gene: ENSMUSG00000074182
AA Change: D419G

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 118 150 N/A INTRINSIC
Pfam:zf-HIT 208 237 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197474
Predicted Effect probably benign
Transcript: ENSMUST00000199033
AA Change: D251G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143306
Gene: ENSMUSG00000074182
AA Change: D251G

DomainStartEndE-ValueType
Pfam:zf-HIT 40 69 4.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Other mutations in Znhit6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znhit6 APN 3 145578160 missense probably damaging 1.00
IGL00969:Znhit6 APN 3 145594596 splice site probably benign
IGL01588:Znhit6 APN 3 145596207 splice site probably benign
IGL01911:Znhit6 APN 3 145578098 splice site probably benign
IGL02118:Znhit6 APN 3 145578104 missense probably damaging 1.00
R1066:Znhit6 UTSW 3 145578497 missense probably damaging 1.00
R1115:Znhit6 UTSW 3 145594685 splice site probably null
R2278:Znhit6 UTSW 3 145576236 unclassified probably benign
R2391:Znhit6 UTSW 3 145594658 missense probably damaging 1.00
R2656:Znhit6 UTSW 3 145578169 critical splice donor site probably null
R2877:Znhit6 UTSW 3 145576654 missense probably benign 0.31
R3825:Znhit6 UTSW 3 145578344 missense probably benign 0.17
R4636:Znhit6 UTSW 3 145600578 splice site silent
R4636:Znhit6 UTSW 3 145600579 missense probably null 0.11
R5964:Znhit6 UTSW 3 145576933 missense possibly damaging 0.66
R5965:Znhit6 UTSW 3 145578348 missense possibly damaging 0.80
R6537:Znhit6 UTSW 3 145594619 missense probably benign 0.32
X0065:Znhit6 UTSW 3 145578486 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGTTCCTGCACACACTG -3'
(R):5'- AGTAGACAGTAAACGACATCTTCAC -3'

Sequencing Primer
(F):5'- AACTCGATGTGTATGTAGCCTAGGC -3'
(R):5'- GACAGTAAACGACATCTTCACAATTC -3'
Posted On2016-07-22