Mutagenetix > Incidental Mutation

Incidental Mutation 'R5295:Lrrc7'

405349

Institutional Source

Beutler Lab

Gene Symbol

Lrrc7

Ensembl Gene

ENSMUSG00000028176

Gene Name

leucine rich repeat containing 7

Synonyms

densin

MMRRC Submission

042878-MU

Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Essential gene?

Probably essential (E-score: 0.801) question?

Stock #

R5295 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

158082891-158562221 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 158170739 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 571 (K571N)

Ref Sequence

ENSEMBL: ENSMUSP00000142498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000106044
AA Change: K571N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: K571N

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1349	1378	2e-11	BLAST
PDZ	1460	1540	1.33e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199890
AA Change: K571N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: K571N

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	9e-6	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1328	1364	1e-15	BLAST
low complexity region	1374	1387	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200137
AA Change: K571N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: K571N

Domain	Start	End	E-Value	Type
LRR	52	69	7.6e-1	SMART
LRR	73	92	4.2e-1	SMART
LRR	96	115	3.4e-1	SMART
LRR	142	164	1.8e-1	SMART
LRR	165	184	1.5e-1	SMART
LRR	188	207	2e-2	SMART
LRR	211	233	1.3e-1	SMART
LRR	234	257	1.7e-1	SMART
LRR	257	276	1e0	SMART
LRR	280	299	3.1e-2	SMART
LRR	303	322	6.6e-1	SMART
LRR	326	345	2.1e-1	SMART
LRR	372	391	1.2e-1	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1302	1331	2e-11	BLAST
PDZ	1413	1493	6.4e-22	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000200196
AA Change: K559N

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk2	C	T	18: 65,305,038	E1095K	probably damaging	Het
Alpl	T	C	4: 137,749,608	T245A	probably benign	Het
Ank2	T	C	3: 127,032,183	H378R	probably damaging	Het
Arhgef1	G	A	7: 24,919,352		probably null	Het
Atp5c1	T	C	2: 10,068,733	R10G	possibly damaging	Het
Cbln3	T	C	14: 55,883,463		probably null	Het
Ccr10	C	T	11: 101,174,285	V140M	possibly damaging	Het
Cep135	T	A	5: 76,593,204	H42Q	possibly damaging	Het
Commd5	C	A	15: 76,900,952	T183K	possibly damaging	Het
Dnajc16	T	C	4: 141,767,928	E493G	possibly damaging	Het
Ears2	T	C	7: 122,048,198	R288G	probably damaging	Het
Elovl4	G	A	9: 83,780,661	P273L	possibly damaging	Het
Fam186b	T	A	15: 99,283,874	I148F	probably damaging	Het
Fryl	T	C	5: 73,112,791	Y79C	probably damaging	Het
Gad1-ps	A	G	10: 99,444,889		noncoding transcript	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm8882	T	G	6: 132,361,877	Q126P	unknown	Het
Ighv1-77	T	A	12: 115,861,908	S104C	probably damaging	Het
Kcnv1	T	C	15: 45,114,591	D17G	unknown	Het
Lmtk3	G	A	7: 45,791,298	D243N	probably damaging	Het
Lsm7	T	C	10: 80,854,620	E32G	probably damaging	Het
Ly6f	A	G	15: 75,271,639	Q65R	probably benign	Het
Perm1	T	C	4: 156,217,518	L173P	probably benign	Het
Plvap	T	C	8: 71,511,670	Q16R	probably benign	Het
Prl7d1	A	T	13: 27,709,247	V227D	probably damaging	Het
Prss54	T	C	8: 95,564,478	T165A	probably damaging	Het
Psrc1	A	G	3: 108,386,359	I195V	probably benign	Het
Rnf123	AT	ATT	9: 108,064,003		probably null	Het
Rnf213	A	T	11: 119,440,816	T2284S	probably benign	Het
Serpina3c	T	C	12: 104,148,378	E333G	probably damaging	Het
Serpinb6c	A	G	13: 33,893,817	F190S	probably damaging	Het
Sfmbt1	G	A	14: 30,774,029	D90N	probably damaging	Het
Tdh	T	C	14: 63,496,109	Y110C	probably damaging	Het
Tdrd9	T	A	12: 112,051,912	L1255*	probably null	Het
Trim41	TTCCTCCTCCTCCTCCTCCTCCTCCTCC	TTCCTCCTCCTCCTCCTCCTCCTCC	11: 48,816,257		probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Zbtb2	T	C	10: 4,368,508	K506R	probably damaging	Het
Zmiz1	T	C	14: 25,656,347	L800P	probably damaging	Het
Znhit6	A	G	3: 145,600,493	D251G	probably benign	Het

Other mutations in Lrrc7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Lrrc7	APN	3	158187010	missense	probably benign	0.07
IGL00644:Lrrc7	APN	3	158202368	nonsense	probably null
IGL00822:Lrrc7	APN	3	158185474	missense	probably damaging	0.99
IGL00927:Lrrc7	APN	3	158161090	missense	possibly damaging	0.94
IGL00946:Lrrc7	APN	3	158161356	missense	probably benign	0.07
IGL00948:Lrrc7	APN	3	158161557	missense	probably damaging	1.00
IGL01838:Lrrc7	APN	3	158185463	missense	probably damaging	1.00
IGL01874:Lrrc7	APN	3	158240443	splice site	probably benign
IGL02514:Lrrc7	APN	3	158160292	missense	probably damaging	0.96
IGL02545:Lrrc7	APN	3	158185374	splice site	probably benign
IGL02665:Lrrc7	APN	3	158161105	missense	probably damaging	0.99
IGL03129:Lrrc7	APN	3	158161059	missense	probably benign	0.02
N/A:Lrrc7	UTSW	3	158160340	missense	probably benign
R0021:Lrrc7	UTSW	3	158160661	missense	probably damaging	1.00
R0041:Lrrc7	UTSW	3	158164260	splice site	probably benign
R0255:Lrrc7	UTSW	3	158160838	nonsense	probably null
R0278:Lrrc7	UTSW	3	158179795	missense	possibly damaging	0.96
R0409:Lrrc7	UTSW	3	158161426	missense	possibly damaging	0.59
R0612:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R0866:Lrrc7	UTSW	3	158164266	splice site	probably benign
R1077:Lrrc7	UTSW	3	158161143	missense	probably damaging	1.00
R1103:Lrrc7	UTSW	3	158148706	splice site	probably benign
R1157:Lrrc7	UTSW	3	158160255	missense	probably damaging	1.00
R1187:Lrrc7	UTSW	3	158160402	missense	probably damaging	1.00
R1301:Lrrc7	UTSW	3	158135331	missense	probably benign	0.20
R1433:Lrrc7	UTSW	3	158177306	missense	probably damaging	1.00
R1450:Lrrc7	UTSW	3	158187044	missense	possibly damaging	0.62
R1595:Lrrc7	UTSW	3	158177277	nonsense	probably null
R1659:Lrrc7	UTSW	3	158161408	missense	probably damaging	1.00
R1693:Lrrc7	UTSW	3	158084533	missense	possibly damaging	0.95
R1774:Lrrc7	UTSW	3	158160292	missense	possibly damaging	0.88
R2273:Lrrc7	UTSW	3	158187059	missense	probably damaging	1.00
R2276:Lrrc7	UTSW	3	158179792	missense	probably damaging	1.00
R2302:Lrrc7	UTSW	3	158135244	missense	probably damaging	0.99
R2326:Lrrc7	UTSW	3	158170661	missense	probably damaging	1.00
R2371:Lrrc7	UTSW	3	158161060	missense	probably damaging	0.99
R2383:Lrrc7	UTSW	3	158163956	missense	probably benign
R2679:Lrrc7	UTSW	3	158175108	nonsense	probably null
R2698:Lrrc7	UTSW	3	158135391	missense	probably benign	0.22
R2858:Lrrc7	UTSW	3	158161725	missense	probably damaging	0.99
R3758:Lrrc7	UTSW	3	158163965	missense	probably damaging	1.00
R3791:Lrrc7	UTSW	3	158163956	missense	probably benign
R3805:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3806:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3807:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3892:Lrrc7	UTSW	3	158160696	missense	probably benign	0.08
R3912:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3913:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3963:Lrrc7	UTSW	3	158160405	missense	probably damaging	1.00
R4665:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4666:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4671:Lrrc7	UTSW	3	158202495	critical splice acceptor site	probably null
R4688:Lrrc7	UTSW	3	158148605	missense	probably damaging	1.00
R4725:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4726:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4728:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4783:Lrrc7	UTSW	3	158127213	critical splice donor site	probably null
R4867:Lrrc7	UTSW	3	158161005	missense	probably damaging	1.00
R4907:Lrrc7	UTSW	3	158161240	missense	probably damaging	1.00
R5032:Lrrc7	UTSW	3	158181580	missense	possibly damaging	0.85
R5107:Lrrc7	UTSW	3	158161896	missense	probably damaging	1.00
R5348:Lrrc7	UTSW	3	158175326	missense	probably benign	0.02
R5468:Lrrc7	UTSW	3	158318436	missense	probably damaging	1.00
R5778:Lrrc7	UTSW	3	158170743	missense	probably damaging	1.00
R5897:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R6179:Lrrc7	UTSW	3	158353432	missense	probably damaging	0.99
R6312:Lrrc7	UTSW	3	158160609	missense	probably benign	0.04
R6313:Lrrc7	UTSW	3	158160736	missense	probably damaging	1.00
R6366:Lrrc7	UTSW	3	158135375	missense	probably benign	0.04
R6389:Lrrc7	UTSW	3	158185426	missense	probably damaging	1.00
R6638:Lrrc7	UTSW	3	158135303	missense	probably benign	0.20
R6956:Lrrc7	UTSW	3	158289031	missense	probably benign	0.02
R6969:Lrrc7	UTSW	3	158156913	missense	probably benign	0.19
R7073:Lrrc7	UTSW	3	158127247	missense	probably damaging	1.00
R7313:Lrrc7	UTSW	3	158160474	missense	probably damaging	1.00
R7365:Lrrc7	UTSW	3	158198161	missense	probably damaging	1.00
R7398:Lrrc7	UTSW	3	158291958	nonsense	probably null
R7403:Lrrc7	UTSW	3	158148674	nonsense	probably null
R7407:Lrrc7	UTSW	3	158135241	missense	probably damaging	1.00
R7427:Lrrc7	UTSW	3	158198141	missense	probably benign	0.06
R7453:Lrrc7	UTSW	3	158185409	missense	probably benign	0.00
R7461:Lrrc7	UTSW	3	158187020	missense	probably benign	0.00
R7807:Lrrc7	UTSW	3	158160487	missense	probably damaging	1.00
R7872:Lrrc7	UTSW	3	158353462	missense	probably damaging	0.99
R8215:Lrrc7	UTSW	3	158209750	missense	probably benign
R8367:Lrrc7	UTSW	3	158202370	missense	possibly damaging	0.80
R8867:Lrrc7	UTSW	3	158161884	missense	probably damaging	0.99
R8880:Lrrc7	UTSW	3	158161744	missense	probably damaging	0.99
R8941:Lrrc7	UTSW	3	158163956	missense	probably benign
R8958:Lrrc7	UTSW	3	158240501	missense	probably benign	0.02
R9068:Lrrc7	UTSW	3	158240501	missense	probably benign	0.02
R9069:Lrrc7	UTSW	3	158240501	missense	probably benign	0.02
R9180:Lrrc7	UTSW	3	158161374	missense	possibly damaging	0.61
R9193:Lrrc7	UTSW	3	158353374	nonsense	probably null
R9309:Lrrc7	UTSW	3	158209724	nonsense	probably null
R9418:Lrrc7	UTSW	3	158202386	missense	possibly damaging	0.66
R9474:Lrrc7	UTSW	3	158135391	missense	probably benign	0.22
R9515:Lrrc7	UTSW	3	158161468	missense	probably damaging	1.00
R9635:Lrrc7	UTSW	3	158240501	missense	probably benign	0.02
R9639:Lrrc7	UTSW	3	158240501	missense	probably benign	0.02
R9682:Lrrc7	UTSW	3	158177317	missense	possibly damaging	0.92
R9731:Lrrc7	UTSW	3	158175251	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCATCACGCAGAAGTCTAAAAGTC -3'
(R):5'- GCCCCACAGAGTTCAATATGC -3'

Sequencing Primer
(F):5'- CCACTGTAATCTCCTTTGGGG -3'
(R):5'- GAGTTCAATATGCATCAAGCCC -3'

Posted On

2016-07-22