Incidental Mutation 'R5295:Alpl'
ID 405350
Institutional Source Beutler Lab
Gene Symbol Alpl
Ensembl Gene ENSMUSG00000028766
Gene Name alkaline phosphatase, liver/bone/kidney
Synonyms TNSALP, TNAP, Akp-2, Akp2
MMRRC Submission 042878-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5295 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 137741733-137796384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137749608 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 245 (T245A)
Ref Sequence ENSEMBL: ENSMUSP00000030551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030551] [ENSMUST00000139951] [ENSMUST00000153588]
AlphaFold P09242
Predicted Effect probably benign
Transcript: ENSMUST00000030551
AA Change: T245A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030551
Gene: ENSMUSG00000028766
AA Change: T245A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
alkPPc 52 491 4.69e-285 SMART
low complexity region 500 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139951
SMART Domains Protein: ENSMUSP00000125041
Gene: ENSMUSG00000028766

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 216 5.2e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141451
Predicted Effect probably benign
Transcript: ENSMUST00000153588
SMART Domains Protein: ENSMUSP00000116308
Gene: ENSMUSG00000028766

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Alk_phosphatase 51 158 2e-44 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a preproprotein that is proteolytically cleaved to yield a signal peptide and a proproptein that is subsequently processed to generate the active mature peptide. The encoded protein is a membrane-bound glycosylated enzyme that catalyzes the hydrolysis of phosphate esters at alkaline pH. The mature peptide maintains the ratio of inorganic phosphate to inorganic pyrophosphate required for bone mineralization. Mice that lack this enzyme show symptoms of osteomalacia, softening of the bones. In humans, mutations in this gene are associated with hypophosphatasia, an inherited metabolic bone disease in which deficiency of this enzyme inhibits bone mineralization leading to skeletal defects. Mutations in the mouse gene mirror the symptoms of human hypophosphatasia. A pseudogene of this gene is present on chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Males hemizygous for a null mutation exhibit reduced body size, shortened hindlimbs and tail, osteomalacia, and markedly reduced plasma phosphate levels due to impaired kidney reabsorption. Female heterozygotes exhibit milder symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Alpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Alpl APN 4 137743313 splice site probably benign
IGL02164:Alpl APN 4 137753979 missense probably damaging 1.00
IGL02379:Alpl APN 4 137742558 missense probably damaging 1.00
IGL02632:Alpl APN 4 137753906 missense probably damaging 0.98
IGL02926:Alpl APN 4 137742634 missense probably damaging 1.00
R0492:Alpl UTSW 4 137749576 splice site probably null
R1157:Alpl UTSW 4 137754020 missense probably damaging 1.00
R2013:Alpl UTSW 4 137755147 missense probably benign 0.00
R2067:Alpl UTSW 4 137749545 unclassified probably benign
R4412:Alpl UTSW 4 137758628 missense possibly damaging 0.84
R4440:Alpl UTSW 4 137747813 missense probably damaging 1.00
R5275:Alpl UTSW 4 137749608 missense probably benign 0.00
R5529:Alpl UTSW 4 137746422 missense probably damaging 0.99
R6706:Alpl UTSW 4 137746429 missense probably benign 0.00
R7291:Alpl UTSW 4 137752698 missense probably damaging 1.00
R7693:Alpl UTSW 4 137743809 missense probably damaging 1.00
R7694:Alpl UTSW 4 137743809 missense probably damaging 1.00
R8247:Alpl UTSW 4 137746453 missense probably damaging 1.00
R8686:Alpl UTSW 4 137743801 missense probably damaging 1.00
R8725:Alpl UTSW 4 137747816 missense probably benign
R8727:Alpl UTSW 4 137747816 missense probably benign
X0017:Alpl UTSW 4 137746467 missense probably damaging 1.00
Z1176:Alpl UTSW 4 137754010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGTCAGTACGGTAGAGC -3'
(R):5'- AATCGTTCAGAGAGGGAGCC -3'

Sequencing Primer
(F):5'- GCAAACAGAGGAACATCTGGACTC -3'
(R):5'- TTGCCTAGCTGGACAACCGTC -3'
Posted On 2016-07-22