Incidental Mutation 'R5295:Gm8882'
ID405355
Institutional Source Beutler Lab
Gene Symbol Gm8882
Ensembl Gene ENSMUSG00000030143
Gene Namepredicted gene 8882
Synonyms
MMRRC Submission 042878-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5295 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132361041-132364134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 132361877 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 126 (Q126P)
Ref Sequence ENSEMBL: ENSMUSP00000079660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080849]
Predicted Effect unknown
Transcript: ENSMUST00000080849
AA Change: Q126P
SMART Domains Protein: ENSMUSP00000079660
Gene: ENSMUSG00000030143
AA Change: Q126P

DomainStartEndE-ValueType
Pfam:Pro-rich 1 118 2.2e-32 PFAM
Pfam:Pro-rich 155 228 6.3e-14 PFAM
Pfam:Pro-rich 211 277 5.8e-10 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk2 C T 18: 65,305,038 E1095K probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Cbln3 T C 14: 55,883,463 probably null Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Commd5 C A 15: 76,900,952 T183K possibly damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fam186b T A 15: 99,283,874 I148F probably damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Ighv1-77 T A 12: 115,861,908 S104C probably damaging Het
Kcnv1 T C 15: 45,114,591 D17G unknown Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lrrc7 T A 3: 158,170,739 K571N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Ly6f A G 15: 75,271,639 Q65R probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Rnf213 A T 11: 119,440,816 T2284S probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Sfmbt1 G A 14: 30,774,029 D90N probably damaging Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Zmiz1 T C 14: 25,656,347 L800P probably damaging Het
Znhit6 A G 3: 145,600,493 D251G probably benign Het
Other mutations in Gm8882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02797:Gm8882 APN 6 132363045 critical splice acceptor site probably null
IGL02961:Gm8882 APN 6 132361408 missense unknown
R0334:Gm8882 UTSW 6 132364058 missense unknown
R1167:Gm8882 UTSW 6 132361590 missense unknown
R1635:Gm8882 UTSW 6 132363006 critical splice donor site probably null
R3956:Gm8882 UTSW 6 132361851 missense unknown
R4734:Gm8882 UTSW 6 132361928 missense unknown
R5275:Gm8882 UTSW 6 132361877 missense unknown
R5506:Gm8882 UTSW 6 132361856 missense unknown
R5580:Gm8882 UTSW 6 132361469 missense unknown
R5975:Gm8882 UTSW 6 132362073 missense unknown
R6503:Gm8882 UTSW 6 132361692 nonsense probably null
R8110:Gm8882 UTSW 6 132361568 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGTTTCCAGGCCTAGGAG -3'
(R):5'- TTTCCAAAACCACCTCCTGGAG -3'

Sequencing Primer
(F):5'- TTTCCAGGCCTAGGAGGTC -3'
(R):5'- GACCTCCCAGTTCTGATGAAAATG -3'
Posted On2016-07-22